RNF114 cdna clone
RNF114 cDNA Clone
Gene Names
RNF114; ZNF313; PSORS12
Synonyms
RNF114; RNF114 cDNA Clone; RNF114 cdna clone
Sequence
atggcggcgcaacagcgggactgcgggggtgctgcgcagctggcggggccggcggcggaggctgaccccctaggacgcttcacgtgtcccgtgtgcttagaggtgtacgagaagccggtacaggtgccctgcggacacgtcttttgctctgcatgcctgcaggaatgtctgaagccgaagaagcctgtctgtggggtgtgtcgcagcgctctggcacctggcgtccgagccgtggagctcgagcggcagatcgagagcacagagacttcttgccatggctgccgtaagaatttcttcctgtccaagatccggtcccacgtggctacttgttccaaataccagaattacatcatggaaggtgtgaaggccaccattaaggatgcatctcttcagccaaggaatgttccaaaccgttacacctttccttgtccttactgtcctgagaagaactttgatcaggaaggacttgtggaacactgcaaattattccatagcacggataccaaatctgtggtttgtccgatatgtgcctcgatgccctggggagaccccaactaccgcagcgccaacttcagagagcacatccagcgccggcaccggttttcttatgacacttttgtggattatgatgttgatgaagaggacatgatgaatcaggtgttgcagcgctccatcatcgaccagtga
Sequence Length
687
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
21,004 Da
NCBI Official Full Name
Homo sapiens ring finger protein 114, mRNA
NCBI Official Synonym Full Names
ring finger protein 114
NCBI Official Symbol
RNF114
NCBI Official Synonym Symbols
ZNF313; PSORS12
NCBI Protein Information
E3 ubiquitin-protein ligase RNF114
UniProt Protein Name
E3 ubiquitin-protein ligase RNF114
Protein Family
UniProt Gene Name
RNF114
UniProt Synonym Gene Names
ZNF228; ZNF313
UniProt Entry Name
RN114_HUMAN
Uniprot Description
ZNF313: May play a role in spermatogenesis. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; Ubiquitin ligase; Transcription factor
Chromosomal Location of Human Ortholog: 20q13.13
Cellular Component: cytosol; intracellular
Molecular Function: ubiquitin conjugating enzyme binding; ubiquitin-protein ligase activity
Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination
Research Articles on RNF114
Similar Products
Product Notes
The RNF114 rnf114 (Catalog #AAA1270801) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc aacagcggga ctgcgggggt gctgcgcagc tggcggggcc ggcggcggag gctgaccccc taggacgctt cacgtgtccc gtgtgcttag aggtgtacga gaagccggta caggtgccct gcggacacgt cttttgctct gcatgcctgc aggaatgtct gaagccgaag aagcctgtct gtggggtgtg tcgcagcgct ctggcacctg gcgtccgagc cgtggagctc gagcggcaga tcgagagcac agagacttct tgccatggct gccgtaagaa tttcttcctg tccaagatcc ggtcccacgt ggctacttgt tccaaatacc agaattacat catggaaggt gtgaaggcca ccattaagga tgcatctctt cagccaagga atgttccaaa ccgttacacc tttccttgtc cttactgtcc tgagaagaac tttgatcagg aaggacttgt ggaacactgc aaattattcc atagcacgga taccaaatct gtggtttgtc cgatatgtgc ctcgatgccc tggggagacc ccaactaccg cagcgccaac ttcagagagc acatccagcg ccggcaccgg ttttcttatg acacttttgt ggattatgat gttgatgaag aggacatgat gaatcaggtg ttgcagcgct ccatcatcga ccagtga. It is sometimes possible for the material contained within the vial of "RNF114, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
