GMEB1 cdna clone
GMEB1 cDNA Clone
Gene Names
GMEB1; PIF96; P96PIF
Synonyms
GMEB1; GMEB1 cDNA Clone; GMEB1 cdna clone
Sequence
atggctaatgcagaagtgagtgtcccagtgggggatgtggttgtggtacctactgaaggaaatgaaggggagaatcctgaagacactaaaacccaagtgattttgcagttacagcctgtgcaacaagggatttatgaagctgggtcggagaacaacacggcagttgtagcagtagaaactcacacgatacacaaaattgaagaagggattgatacaggcactatagaagcaaatgaggatatggaaattgcttaccccataacttgtggggagagcaaagccatcctcctctggaagaagtttgtatgtccaggaataaacgtgaagtgtgtcaagttcaatgatcagttgatcagccccaagcactttgttcatctggctggcaagtccactctgaaggactggaagagagctattcgtctgggtgggatcatgctcaggaaaatgatggactccggacagattgatttttaccaacatgacaaagtttgctccaatacctgcagaagcaccaaatttgatcttctgatcagcagtgcaagagctccagtgccaggacagcagacaagtgtggtgcagacacccacttcggctgatggtagcatcacgcagattgccatctcagaagagagcatggaagaggcagggctggaatggaactcagctctcaccgctgctgtcaccatggccacggaggagggtgtaaagaaagactcagaggaaatttcagaggacactttgatgttctggaaaggaatagctgatgtagggctgatggaagaggttgtctgcaatatacagaaggaaatagaggagctactcaggggagttcagcagcggctcatccaggctcccttccaagtcacagatgctgctgttctcaacaatgtagcacacacatttggcctaatggacacagtcaagaaggttttagacaacagaaggaaccaagtagagcagggagaagaacagtttctctatactctgacagacttggaacgccagttggaggagcagaagaagcaaggccaggatcacaggctgaaatctcagacagttcaaaatgtggtactgatgcctgtgagcactcctaagcctccaaaaaggccccggctccagcggccagcctccaccactgtcttgagcccttctcctcctgtccagcagcctcagttcacagtcatctcacccatcaccatcaccccagtgggtcagtcattttccatgggcaatattccagtggccaccctcagccagggctccagtcctgtgactgtccacacactgccttctggccctcagctcttccgctatgccacagtggtctcctctgccaagagcagctcaccagacacagtgaccatccacccttcatctagcttggcgctgctgagctctactgccatgcaggatgggagtacactgggcaacatgaccaccatggttagccctgtggaattggtggccatggagtccggcctaacctcggcaattcaggctgttgaaagcacctcagaggatgggcagaccatcattgagattgatccagccccggacccagaagctgaagatactgagggcaaagcagtcatcttggagacagagctgaggactgaggagaaagttgtggctgagatggaagaacaccagcatcaagttcacaatgtggagattgtggtcttagaggattaa
Sequence Length
1692
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,327 Da
NCBI Official Full Name
Homo sapiens glucocorticoid modulatory element binding protein 1, mRNA
NCBI Official Synonym Full Names
glucocorticoid modulatory element binding protein 1
NCBI Official Symbol
GMEB1
NCBI Official Synonym Symbols
PIF96; P96PIF
NCBI Protein Information
glucocorticoid modulatory element-binding protein 1
UniProt Protein Name
Glucocorticoid modulatory element-binding protein 1
Protein Family
UniProt Gene Name
GMEB1
UniProt Synonym Gene Names
GMEB-1; PIF p96
UniProt Entry Name
GMEB1_HUMAN
NCBI Description
This gene encodes a member of KDWK gene family which associates with GMEB2 protein. The GMEB1-GMEB2 complex is essential for parvovirus DNA replication. Studies in rat for a similar gene suggest that this gene's role is to modulate the transactivation of the glucocorticoid receptor when it is bound to glucocorticoid response elements. Three alternative spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Feb 2016]
Uniprot Description
GMEB1: Trans-acting factor that binds to glucocorticoid modulatory elements (GME) present in the TAT (tyrosine aminotransferase) promoter and increases sensitivity to low concentrations of glucocorticoids. Binds also to the transferrin receptor promoter. Essential auxiliary factor for the replication of parvoviruses. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Nuclear receptor co-regulator
Chromosomal Location of Human Ortholog: 1p35.3
Cellular Component: nucleoplasm; nucleus
Biological Process: regulation of transcription from RNA polymerase II promoter
Research Articles on GMEB1
Similar Products
Product Notes
The GMEB1 gmeb1 (Catalog #AAA1270785) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaatg cagaagtgag tgtcccagtg ggggatgtgg ttgtggtacc tactgaagga aatgaagggg agaatcctga agacactaaa acccaagtga ttttgcagtt acagcctgtg caacaaggga tttatgaagc tgggtcggag aacaacacgg cagttgtagc agtagaaact cacacgatac acaaaattga agaagggatt gatacaggca ctatagaagc aaatgaggat atggaaattg cttaccccat aacttgtggg gagagcaaag ccatcctcct ctggaagaag tttgtatgtc caggaataaa cgtgaagtgt gtcaagttca atgatcagtt gatcagcccc aagcactttg ttcatctggc tggcaagtcc actctgaagg actggaagag agctattcgt ctgggtggga tcatgctcag gaaaatgatg gactccggac agattgattt ttaccaacat gacaaagttt gctccaatac ctgcagaagc accaaatttg atcttctgat cagcagtgca agagctccag tgccaggaca gcagacaagt gtggtgcaga cacccacttc ggctgatggt agcatcacgc agattgccat ctcagaagag agcatggaag aggcagggct ggaatggaac tcagctctca ccgctgctgt caccatggcc acggaggagg gtgtaaagaa agactcagag gaaatttcag aggacacttt gatgttctgg aaaggaatag ctgatgtagg gctgatggaa gaggttgtct gcaatataca gaaggaaata gaggagctac tcaggggagt tcagcagcgg ctcatccagg ctcccttcca agtcacagat gctgctgttc tcaacaatgt agcacacaca tttggcctaa tggacacagt caagaaggtt ttagacaaca gaaggaacca agtagagcag ggagaagaac agtttctcta tactctgaca gacttggaac gccagttgga ggagcagaag aagcaaggcc aggatcacag gctgaaatct cagacagttc aaaatgtggt actgatgcct gtgagcactc ctaagcctcc aaaaaggccc cggctccagc ggccagcctc caccactgtc ttgagccctt ctcctcctgt ccagcagcct cagttcacag tcatctcacc catcaccatc accccagtgg gtcagtcatt ttccatgggc aatattccag tggccaccct cagccagggc tccagtcctg tgactgtcca cacactgcct tctggccctc agctcttccg ctatgccaca gtggtctcct ctgccaagag cagctcacca gacacagtga ccatccaccc ttcatctagc ttggcgctgc tgagctctac tgccatgcag gatgggagta cactgggcaa catgaccacc atggttagcc ctgtggaatt ggtggccatg gagtccggcc taacctcggc aattcaggct gttgaaagca cctcagagga tgggcagacc atcattgaga ttgatccagc cccggaccca gaagctgaag atactgaggg caaagcagtc atcttggaga cagagctgag gactgaggag aaagttgtgg ctgagatgga agaacaccag catcaagttc acaatgtgga gattgtggtc ttagaggatt aa. It is sometimes possible for the material contained within the vial of "GMEB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
