ATP10D cdna clone

ATP10D cDNA Clone

Gene Names

ATP10D; ATPVD

Synonyms

ATP10D; ATP10D cDNA Clone; ATP10D cdna clone

Ordering
Cat. Num. AAA1270500 For Research Use Only!

Sequence

atgactgaggctctccaatgggccagatatcactggcgacggctgatcagaggtgcaaccagggatgatgattcagggccatacaactattcctcgttgctcgcctgtgggcgcaagtcctctcagacccctaaactgtcaggaaggcaccggattgttgttccccacatccagcccttcaaggatgagtatgagaagttctccggagcctatgtgaacaatcgaatacgaacaacaaagtacacacttctgaattttgtgccaagaaatttatttgaacaatttcacagagctgccaatttatatttcctgttcctagttgtcctgaactgggtacctttggtagaagccttccaaaaggaaatcaccatgttgcctctggtggtggtccttacaattatcgcaattaaagatggcctggaagattatcggaaatacaaaattgacaaacagatcaataatttaataactaaagtttatagtaggaaagagaaaaaatacattgaccgatgctggaaagacgttactgttggggactttattcgcctctcctgcaacgaggtcatccctgcagacatggtactactcttttccactgatccagatggaatctgtcacattgagacttctggtcttgatggagagagcaatttaaaacagaggcaggtggttcggggatatgcagaacaggactctgaagttgatcctgagaagttttccagtaggatagaatgtgaaagcccaaacaatgacctcagcagattccgaggcttcctagaacattccaacaaagaacgcgtgggtctcagtaaagaaaatttgttgcttagaggatgcaccattagaaacacagaggctgttgtgggcattgtggtttatgcaggccatgaaaccaaagcaatgctgaacaacagtgggccacggtataagcgcagcaaattagaaagaagagcaaacacagatgtcctctggtgtgtcatgcttctggtcataatgtgcttaactggcgcagtaggtcatggaatctggctgagcaggtatgaaaagatgcattttttcaatgttcccgagcctgatggacatatcatatcaccactgttggcaggattttatatgttttggaccatgatcattttgttacagcttggacaaatatatttcattcaaagtgatgtggatttctacaatgaaaaaatggattctattgttcagtgccgagccctgaacatcgccgaggatctgggacagattcagtacctcttttccgataagacaggaaccctcactgagaataagatggtttttcgaagatgtagtgtggcaggatttgattactgccatgaagaaaatgccaggaggttggagtcctatcaggaagctgtctctgaagatgaagattttatagacacagtcagtggttccctcagcaatatggcaaaaccgagagcccccagctgcaggacagttcataatgggcctttgggaaataagccctcaaatcatcttgctgggagctcttttactctaggaagtggagaaggagccagtgaagtgcctcattccagacaggctgctttcagtagccccattgtaagtatgaatgcatga

Sequence Length

1608

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

34785953

NCBI GeneID

57205

Molecular Weight

138,890 Da

NCBI Official Full Name

Homo sapiens ATPase, class V, type 10D, mRNA

NCBI Official Synonym Full Names

ATPase phospholipid transporting 10D (putative)

NCBI Official Symbol

ATP10D

NCBI Official Synonym Symbols

ATPVD

NCBI Protein Information

probable phospholipid-transporting ATPase VD

UniProt Protein Name

Probable phospholipid-transporting ATPase VD

Protein Family

Probable phospholipid-transporting ATPase

UniProt Gene Name

ATP10D

UniProt Synonym Gene Names

ATPVD; KIAA1487

UniProt Entry Name

AT10D_HUMAN

Uniprot Description

ATP10D: Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IV subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, ion channel; Membrane protein, multi-pass; Transporter; Membrane protein, integral; Hydrolase; EC 3.6.3.1

Chromosomal Location of Human Ortholog: 4p12

Cellular Component: endoplasmic reticulum; nucleoplasm; plasma membrane

Molecular Function: phospholipid-translocating ATPase activity; protein binding

Research Articles on ATP10D

1. The rs2351791 SNP in the Atp10d gene affects the susceptibility for cardiac and intracranial vascular stenosis in the elderly Japanese population.

Similar Products

Product Notes

The ATP10D atp10d (Catalog #AAA1270500) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgagg ctctccaatg ggccagatat cactggcgac ggctgatcag aggtgcaacc agggatgatg attcagggcc atacaactat tcctcgttgc tcgcctgtgg gcgcaagtcc tctcagaccc ctaaactgtc aggaaggcac cggattgttg ttccccacat ccagcccttc aaggatgagt atgagaagtt ctccggagcc tatgtgaaca atcgaatacg aacaacaaag tacacacttc tgaattttgt gccaagaaat ttatttgaac aatttcacag agctgccaat ttatatttcc tgttcctagt tgtcctgaac tgggtacctt tggtagaagc cttccaaaag gaaatcacca tgttgcctct ggtggtggtc cttacaatta tcgcaattaa agatggcctg gaagattatc ggaaatacaa aattgacaaa cagatcaata atttaataac taaagtttat agtaggaaag agaaaaaata cattgaccga tgctggaaag acgttactgt tggggacttt attcgcctct cctgcaacga ggtcatccct gcagacatgg tactactctt ttccactgat ccagatggaa tctgtcacat tgagacttct ggtcttgatg gagagagcaa tttaaaacag aggcaggtgg ttcggggata tgcagaacag gactctgaag ttgatcctga gaagttttcc agtaggatag aatgtgaaag cccaaacaat gacctcagca gattccgagg cttcctagaa cattccaaca aagaacgcgt gggtctcagt aaagaaaatt tgttgcttag aggatgcacc attagaaaca cagaggctgt tgtgggcatt gtggtttatg caggccatga aaccaaagca atgctgaaca acagtgggcc acggtataag cgcagcaaat tagaaagaag agcaaacaca gatgtcctct ggtgtgtcat gcttctggtc ataatgtgct taactggcgc agtaggtcat ggaatctggc tgagcaggta tgaaaagatg cattttttca atgttcccga gcctgatgga catatcatat caccactgtt ggcaggattt tatatgtttt ggaccatgat cattttgtta cagcttggac aaatatattt cattcaaagt gatgtggatt tctacaatga aaaaatggat tctattgttc agtgccgagc cctgaacatc gccgaggatc tgggacagat tcagtacctc ttttccgata agacaggaac cctcactgag aataagatgg tttttcgaag atgtagtgtg gcaggatttg attactgcca tgaagaaaat gccaggaggt tggagtccta tcaggaagct gtctctgaag atgaagattt tatagacaca gtcagtggtt ccctcagcaa tatggcaaaa ccgagagccc ccagctgcag gacagttcat aatgggcctt tgggaaataa gccctcaaat catcttgctg ggagctcttt tactctagga agtggagaag gagccagtga agtgcctcat tccagacagg ctgctttcag tagccccatt gtaagtatga atgcatga. It is sometimes possible for the material contained within the vial of "ATP10D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ATP10D cdna clone