Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMED7 cdna clone

TMED7 cDNA Clone

Gene Names
TMED7; p27; p24g3; CGI-109; p24gamma3
Synonyms
TMED7; TMED7 cDNA Clone; TMED7 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgcggccggggtccgcgcagcgctgggcggccgtcgcgggccgttgggggtgcaggctgctcgcactgctgctactggtgcctggacccggcggcgcctctgagatcaccttcgagcttcctgacaacgccaagcagtgcttctacgaggacatcgctcagggcaccaagtgcaccctggagttccaggtgattactggtggtcactatgatgtagattgtcgattagaagatcctgatggtaaagtgttatacaaagagatgaagaaacagtatgatagttttaccttcacagcctccaaaaatgggacatacaaattttgcttcagcaatgaattttctactttcacacataaaactgtatattttgattttcaagttggagaagacccacctttgtttcctagtgagaaccgagtcagtgctcttacccagatggaatctgcctgtgtttcaattcacgaagctctgaagtctgtcatcgattatcagactcatttccgtttaagagaagctcaaggccgaagccgagcagaggatctaaatacaagagtggcctattggtcagtaggagaagccctcattcttctggtggttagcatagggcaggtatttcttttgaaaagctttttctcagataaaagaaccaccacaactcgtgttggatcataa
Sequence Length
675
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,233 Da
NCBI Official Full Name
Homo sapiens transmembrane emp24 protein transport domain containing 7, mRNA
NCBI Official Synonym Full Names
transmembrane p24 trafficking protein 7
NCBI Official Symbol
TMED7
NCBI Official Synonym Symbols
p27; p24g3; CGI-109; p24gamma3
NCBI Protein Information
transmembrane emp24 domain-containing protein 7
UniProt Protein Name
Transmembrane emp24 domain-containing protein 7
UniProt Gene Name
TMED7
UniProt Synonym Gene Names
p24gamma3
UniProt Entry Name
TMED7_HUMAN

Uniprot Description

TMED7: Potential role in vesicular protein trafficking, mainly in the early secretory pathway. Appears to play a role in the biosynthesis of secreted cargo including processing and post- translational modifications. Belongs to the EMP24/GP25L family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q22.3

Cellular Component: COPI vesicle coat; COPII vesicle coat; endoplasmic reticulum; endoplasmic reticulum membrane; ER-Golgi intermediate compartment; ER-Golgi intermediate compartment membrane; Golgi apparatus; Golgi membrane; transport vesicle

Biological Process: ER to Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on TMED7

Similar Products

Product Notes

The TMED7 tmed7 (Catalog #AAA1270299) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgcggc cggggtccgc gcagcgctgg gcggccgtcg cgggccgttg ggggtgcagg ctgctcgcac tgctgctact ggtgcctgga cccggcggcg cctctgagat caccttcgag cttcctgaca acgccaagca gtgcttctac gaggacatcg ctcagggcac caagtgcacc ctggagttcc aggtgattac tggtggtcac tatgatgtag attgtcgatt agaagatcct gatggtaaag tgttatacaa agagatgaag aaacagtatg atagttttac cttcacagcc tccaaaaatg ggacatacaa attttgcttc agcaatgaat tttctacttt cacacataaa actgtatatt ttgattttca agttggagaa gacccacctt tgtttcctag tgagaaccga gtcagtgctc ttacccagat ggaatctgcc tgtgtttcaa ttcacgaagc tctgaagtct gtcatcgatt atcagactca tttccgttta agagaagctc aaggccgaag ccgagcagag gatctaaata caagagtggc ctattggtca gtaggagaag ccctcattct tctggtggtt agcatagggc aggtatttct tttgaaaagc tttttctcag ataaaagaac caccacaact cgtgttggat cataa. It is sometimes possible for the material contained within the vial of "TMED7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.