Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDK5R1 cdna clone

CDK5R1 cDNA Clone

Gene Names
CDK5R1; p23; p25; p35; CDK5R; NCK5A; CDK5P35; p35nck5a
Synonyms
CDK5R1; CDK5R1 cDNA Clone; CDK5R1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcacggtgctgtccctgtctcccagctaccggaaggccacgctgtttgaggatggcgcggccaccgtgggccactatacggccgtacagaacagcaagaacgccaaggacaagaacctgaagcgccactccatcatctccgtgctgccttggaagagaatcgtggccgtgtcggccaagaagaagaactcaaagaaggtgcagcccaacagcagctaccagaacaacatcacgcacctcaacaatgagaacctgaagaagtcgctgtcgtgcgccaacctgtccacattcgcccagcccccaccggcccagccgcctgcacccccggccagccagctctcgggttcccagaccgggggctcctcctcagtcaagaaagcccctcaccctgccgtcacctccgcagggacgcccaaacgggtcatcgtccaggcgtccaccagtgagctgcttcgctgcctgggtgagtttctctgccgccggtgctaccgcctgaagcacctgtcccccacggaccccgtgctctggctgcgcagcgtggaccgctcgctgcttctgcagggctggcaggacaagggcttcatcacgccggccaacgtggtcttcctctacatgctctgcagggatgttatctcctccgaggtgggctcggatcacgagctccaggccgtcctgctgacatgcctgtacctctcctactcctacatgggcaacgagatctcctacccgctcaagcccttcctggtggagagctgcaaggaggccttttgggaccgttgcctctctgtcatcaacctcatgagctcaaagatgctgcagataaatgccgacccacactacttcacacaggtcttctccgacctgaagaacgagagcggccaggaggacaagaagcggctcctcctaggcctggatcggtga
Sequence Length
924
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,060 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 5, regulatory subunit 1 (p35), mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 5 regulatory subunit 1
NCBI Official Symbol
CDK5R1
NCBI Official Synonym Symbols
p23; p25; p35; CDK5R; NCK5A; CDK5P35; p35nck5a
NCBI Protein Information
cyclin-dependent kinase 5 activator 1
UniProt Protein Name
Cyclin-dependent kinase 5 activator 1
UniProt Gene Name
CDK5R1
UniProt Synonym Gene Names
CDK5R; NCK5A; CDK5 activator 1; p35; p25; p23
UniProt Entry Name
CD5R1_HUMAN

NCBI Description

The protein encoded by this gene (p35) is a neuron-specific activator of cyclin-dependent kinase 5 (CDK5); the activation of CDK5 is required for proper development of the central nervous system. The p35 form of this protein is proteolytically cleaved by calpain, generating a p25 form. The cleavage of p35 into p25 results in relocalization of the protein from the cell periphery to nuclear and perinuclear regions. P25 deregulates CDK5 activity by prolonging its activation and changing its cellular location. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease. This accumulation correlates with an increase in CDK5 kinase activity, and may lead to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease. [provided by RefSeq, Jul 2008]

Uniprot Description

CDK5R1: activator of cyclin-dependent kinase 5 (CDK5). Required for proper development of the central nervous system. The p35 form of this protein is cleaved by calpain, generating a p25 form, resulting in the prolonged activation and relocalization of the CDK5 from the cell periphery to nuclear and perinuclear regions. The p25 form accumulates in the brain neurons of patients with Alzheimer's disease, leading to aberrantly phosphorylated forms of the microtubule-associated protein tau, which contributes to Alzheimer's disease.

Protein type: Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: axon; cell soma; contractile fiber; cytoplasm; cytosol; dendrite; dendritic spine; growth cone; intracellular membrane-bound organelle; membrane; neuromuscular junction; nucleoplasm; nucleus; perinuclear region of cytoplasm; postsynaptic density

Molecular Function: cadherin binding; calcium ion binding; kinase activity; protein binding; protein kinase activity; protein kinase binding; protein serine/threonine kinase activator activity

Biological Process: acetylcholine receptor signaling, muscarinic pathway; axon guidance; axonal fasciculation; brain development; cell proliferation; ephrin receptor signaling pathway; ionotropic glutamate receptor signaling pathway; negative regulation of transcription, DNA-dependent; neurite development; neuron adhesion; neuron differentiation; neuron migration; peptidyl-serine phosphorylation; peptidyl-threonine phosphorylation; positive regulation of neuron apoptosis; regulation of cyclin-dependent protein kinase activity

Research Articles on CDK5R1

Similar Products

Product Notes

The CDK5R1 cdk5r1 (Catalog #AAA1269396) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcacgg tgctgtccct gtctcccagc taccggaagg ccacgctgtt tgaggatggc gcggccaccg tgggccacta tacggccgta cagaacagca agaacgccaa ggacaagaac ctgaagcgcc actccatcat ctccgtgctg ccttggaaga gaatcgtggc cgtgtcggcc aagaagaaga actcaaagaa ggtgcagccc aacagcagct accagaacaa catcacgcac ctcaacaatg agaacctgaa gaagtcgctg tcgtgcgcca acctgtccac attcgcccag cccccaccgg cccagccgcc tgcacccccg gccagccagc tctcgggttc ccagaccggg ggctcctcct cagtcaagaa agcccctcac cctgccgtca cctccgcagg gacgcccaaa cgggtcatcg tccaggcgtc caccagtgag ctgcttcgct gcctgggtga gtttctctgc cgccggtgct accgcctgaa gcacctgtcc cccacggacc ccgtgctctg gctgcgcagc gtggaccgct cgctgcttct gcagggctgg caggacaagg gcttcatcac gccggccaac gtggtcttcc tctacatgct ctgcagggat gttatctcct ccgaggtggg ctcggatcac gagctccagg ccgtcctgct gacatgcctg tacctctcct actcctacat gggcaacgag atctcctacc cgctcaagcc cttcctggtg gagagctgca aggaggcctt ttgggaccgt tgcctctctg tcatcaacct catgagctca aagatgctgc agataaatgc cgacccacac tacttcacac aggtcttctc cgacctgaag aacgagagcg gccaggagga caagaagcgg ctcctcctag gcctggatcg gtga. It is sometimes possible for the material contained within the vial of "CDK5R1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.