Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FHL2 cdna clone

FHL2 cDNA Clone

Gene Names
FHL2; DRAL; AAG11; FHL-2; SLIM3; SLIM-3
Synonyms
FHL2; FHL2 cDNA Clone; FHL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgactgagcgctttgactgccaccattgcaacgaatctctctttggcaagaagtacatcctgcgggaggagagcccctactgcgtggtgtgctttgagaccctgttcgccaacacctgcgaggagtgtgggaagcccatcggctgtgactgcaaggacttgtcttacaaggaccggcactggcatgaagcctgtttccactgctcgcagtgcagaaactcactggtggacaagccctttgctgccaaggaggaccagctgctctgtacagactgctattccaacgagtactcatccaagtgccaggaatgcaagaagaccatcatgccaggtacccgcaagatggagtacaagggcagcagctggcatgagacctgcttcatctgccaccgctgccagcagccaattggaaccaagagtttcatccccaaagacaatcagaatttctgtgtgccctgctatgagaaacaacatgccatgcagtgcgttcagtgcaaaaagcccatcaccacgggaggggtcacttaccgggagcagccctggcacaaggagtgcttcgtgtgcaccgcctgcaggaagcagctgtctgggcagcgcttcacagctcgcgatgactttgcctactgcctgaactgcttctgtgacttgtatgccaagaagtgtgctgggtgcaccaaccccatcagcggacttggtggcacaaaatacatctcctttgaggaacggcagtggcataacgactgctttaactgtaagaagtgctccctctcactggtggggcgtggcttcctcacagagagggacgacatcctgtgccccgactgtgggaaagacatctga
Sequence Length
840
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,890 Da
NCBI Official Full Name
Homo sapiens four and a half LIM domains 2, mRNA
NCBI Official Synonym Full Names
four and a half LIM domains 2
NCBI Official Symbol
FHL2
NCBI Official Synonym Symbols
DRAL; AAG11; FHL-2; SLIM3; SLIM-3
NCBI Protein Information
four and a half LIM domains protein 2
UniProt Protein Name
Four and a half LIM domains protein 2
UniProt Gene Name
FHL2
UniProt Synonym Gene Names
DRAL; SLIM3; FHL-2; SLIM-3
UniProt Entry Name
FHL2_HUMAN

NCBI Description

This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. This protein is thought to have a role in the assembly of extracellular membranes. Also, this gene is down-regulated during transformation of normal myoblasts to rhabdomyosarcoma cells and the encoded protein may function as a link between presenilin-2 and an intracellular signaling pathway. Multiple alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2016]

Uniprot Description

FHL2: May function as a molecular transmitter linking various signaling pathways to transcriptional regulation. Negatively regulates the transcriptional repressor E4F1 and may function in cell growth. Inhibits the transcriptional activity of FOXO1 and its apoptotic function by enhancing the interaction of FOXO1 with SIRT1 and FOXO1 deacetylation.

Protein type: Transcription, coactivator/corepressor; Nuclear receptor co-regulator; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q12.2

Cellular Component: actin cytoskeleton; focal adhesion; nucleoplasm; nucleus

Molecular Function: identical protein binding; protein binding; transcription factor binding

Biological Process: negative regulation of apoptosis; negative regulation of transcription from RNA polymerase II promoter; response to hormone stimulus

Research Articles on FHL2

Similar Products

Product Notes

The FHL2 fhl2 (Catalog #AAA1269135) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgagc gctttgactg ccaccattgc aacgaatctc tctttggcaa gaagtacatc ctgcgggagg agagccccta ctgcgtggtg tgctttgaga ccctgttcgc caacacctgc gaggagtgtg ggaagcccat cggctgtgac tgcaaggact tgtcttacaa ggaccggcac tggcatgaag cctgtttcca ctgctcgcag tgcagaaact cactggtgga caagcccttt gctgccaagg aggaccagct gctctgtaca gactgctatt ccaacgagta ctcatccaag tgccaggaat gcaagaagac catcatgcca ggtacccgca agatggagta caagggcagc agctggcatg agacctgctt catctgccac cgctgccagc agccaattgg aaccaagagt ttcatcccca aagacaatca gaatttctgt gtgccctgct atgagaaaca acatgccatg cagtgcgttc agtgcaaaaa gcccatcacc acgggagggg tcacttaccg ggagcagccc tggcacaagg agtgcttcgt gtgcaccgcc tgcaggaagc agctgtctgg gcagcgcttc acagctcgcg atgactttgc ctactgcctg aactgcttct gtgacttgta tgccaagaag tgtgctgggt gcaccaaccc catcagcgga cttggtggca caaaatacat ctcctttgag gaacggcagt ggcataacga ctgctttaac tgtaagaagt gctccctctc actggtgggg cgtggcttcc tcacagagag ggacgacatc ctgtgccccg actgtgggaa agacatctga. It is sometimes possible for the material contained within the vial of "FHL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.