Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RGS7 cdna clone

RGS7 cDNA Clone

Synonyms
RGS7; RGS7 cDNA Clone; RGS7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccaggggaataattatgggcagaccagcaacggggtggccgatgaatcacccaacatgctggtgtacagaaagatggaagacgtcatagcacggatgcaagatgaaaaaaatggaattcctattcgtacggtcaaaagctttctttccaagatacctagcgtcttctctggttcagacattgttcaatggttgataaagaacttaactatagaagatccagtggaggcgctccatttgggaacattaatggctgcccacggctacttctttccaatctcagatcatgtcctcacactcaaggatgatggcaccttttaccggtttcaaaccccctatttttggccatcaaattgttgggagccggaaaacacagattatgccgtttacctctgcaagagaacaatgcaaaacaaggcacgactggagctcgcagactatgaggctgagagcctggccaggctgcagagagcatttgcccggaagtgggagttcattttcatgcaagcagaagcacaagcaaaagtggacaagaagagagacaagattgaaaggaagatccttgacagccaagagagagcgttctgggacgtgcacaggcccgtgcctggatgtgtaaatacaactgaagtggacattaagaagtcatccagaatgagaaacccccacaaaacacggaagtctgtctatggtttacaaaatgatattagaagtcacagtcctacccacacacccacaccagaaactaaacctccaacagaagatgagttacaacaacagataaaatattggcaaatacagttagatagacatcggttaaaaatgtcaaaagtcgctgacagtctactaagttacacggaacagtatttagaatacgacccgtttcttttgccacctgacccttctaacccatggctgtccgatgacaccactttctgggaacttgaggcaagcaaagaaccgagccagcagagggtaaaacgatggggttttggcatggacgaggcattgaaagacccagttgggagagaacagttccttaaatttctagagtcagaattcagctcggaaaatttaagattctggctggcagtggaggacctgaaaaagaggcctattaaagaagtaccctcaagagttcaggaaatatggcaagagtttctggctcccggagcccccagtgctattaacttggattccaagagttatgacaaaaccacacataacgtgaaggaacctggacgatacacatttgaagatgctcaggagcacatttacaaactgatgaaaagtgattcatacccacgttttataagatccagtgcctatcaggagcttctacaggcaaagaaaaagtctggaaactcaatggatcgcagaacatcttttgaaaaatttgcacagaatgtggggaaatctctcacgtccaagaggttaacaagccttgctcagtcttactaa
Sequence Length
1464
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,741 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 7, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 7
NCBI Official Symbol
RGS7
NCBI Protein Information
regulator of G-protein signaling 7
UniProt Protein Name
Regulator of G-protein signaling 7
UniProt Gene Name
RGS7
UniProt Synonym Gene Names
RGS7
UniProt Entry Name
RGS7_HUMAN

Uniprot Description

RGS7: inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits thereby driving them into their inactive GDP-bound form. Activity on G(o)-alpha is specifically enhanced by the RGS6/GNG5 dimer. May play a role in synaptic vesicle exocytosis. May play important role in the rapid regulation of neuronal excitability and the cellular responses to short-lived stimulations. Heterodimer with GNG5. Interacts with RGS7BP, leading to regulate the subcellular location of the heterodimer formed with Gbeta5 (By similarity). Interacts with 14-3-3 protein Tau and SNAP25BP. Four alternatively spliced isoforms have been described.

Protein type: GAPs, RGS; GAPs

Chromosomal Location of Human Ortholog: 1q43|1q23.1

Cellular Component: cytosol; plasma membrane

Molecular Function: G-protein beta-subunit binding; GTPase activator activity

Biological Process: positive regulation of GTPase activity; protein folding

Research Articles on RGS7

Similar Products

Product Notes

The RGS7 rgs7 (Catalog #AAA1268549) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccagg ggaataatta tgggcagacc agcaacgggg tggccgatga atcacccaac atgctggtgt acagaaagat ggaagacgtc atagcacgga tgcaagatga aaaaaatgga attcctattc gtacggtcaa aagctttctt tccaagatac ctagcgtctt ctctggttca gacattgttc aatggttgat aaagaactta actatagaag atccagtgga ggcgctccat ttgggaacat taatggctgc ccacggctac ttctttccaa tctcagatca tgtcctcaca ctcaaggatg atggcacctt ttaccggttt caaaccccct atttttggcc atcaaattgt tgggagccgg aaaacacaga ttatgccgtt tacctctgca agagaacaat gcaaaacaag gcacgactgg agctcgcaga ctatgaggct gagagcctgg ccaggctgca gagagcattt gcccggaagt gggagttcat tttcatgcaa gcagaagcac aagcaaaagt ggacaagaag agagacaaga ttgaaaggaa gatccttgac agccaagaga gagcgttctg ggacgtgcac aggcccgtgc ctggatgtgt aaatacaact gaagtggaca ttaagaagtc atccagaatg agaaaccccc acaaaacacg gaagtctgtc tatggtttac aaaatgatat tagaagtcac agtcctaccc acacacccac accagaaact aaacctccaa cagaagatga gttacaacaa cagataaaat attggcaaat acagttagat agacatcggt taaaaatgtc aaaagtcgct gacagtctac taagttacac ggaacagtat ttagaatacg acccgtttct tttgccacct gacccttcta acccatggct gtccgatgac accactttct gggaacttga ggcaagcaaa gaaccgagcc agcagagggt aaaacgatgg ggttttggca tggacgaggc attgaaagac ccagttggga gagaacagtt ccttaaattt ctagagtcag aattcagctc ggaaaattta agattctggc tggcagtgga ggacctgaaa aagaggccta ttaaagaagt accctcaaga gttcaggaaa tatggcaaga gtttctggct cccggagccc ccagtgctat taacttggat tccaagagtt atgacaaaac cacacataac gtgaaggaac ctggacgata cacatttgaa gatgctcagg agcacattta caaactgatg aaaagtgatt catacccacg ttttataaga tccagtgcct atcaggagct tctacaggca aagaaaaagt ctggaaactc aatggatcgc agaacatctt ttgaaaaatt tgcacagaat gtggggaaat ctctcacgtc caagaggtta acaagccttg ctcagtctta ctaa. It is sometimes possible for the material contained within the vial of "RGS7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.