UBE2O cdna clone
UBE2O cDNA Clone
Gene Names
UBE2O; E2-230K
Synonyms
UBE2O; UBE2O cDNA Clone; UBE2O cdna clone
Sequence
atgactgtggagcagctgctgacgggctcgcccacctctccgactgtggagcctgagaagccaactcgggagaagaagtttctggatgacatcaagaagctacaggaaaacctcaagaagaccctggacaatgtggccattgtagaggaggagaagatggaagcagtgcccgacgtagagcgcaaggaggacaagcccgaggggcagtcacctgtgaaggctgagtggcccagcgaaaccccggtgctgtgccagcagtgtggcggcaagcctggcgtcaccttcaccagcgccaagggcgaggtcttctccgtactggagtttgcaccctcaaatcattcttttaagaaaattgagttccagcctccagaagccaagaagttcttcagcacagtgcggaaggagatggcgctgctggctacctcactgcctgagggcatcatggtcaagacttttgaagatagaatggacctcttctcagctctcatcaagggccccactcgaaccccctacgaggatggcctctacttgtttgacatccagctccccaacatctacccagccgtgcccccccacttctgctacctctcccaatgcagtggccgcctgaaccccaacctgtatgacaatgggaaggtgtgtgtcagcctcctgggcacctgtattggaaaggggacagagaggtggacaagcaagtccagccttctccaggtgctcatctccatccaaggtctgatcctggtaaatgaaccatactacaacgaagccggcttcgacagtgaccgaggcctgcaggaaggctatgaaaacagtcgctgttacaatgagatggcgctgatccgcgtggtgcagtccatgacccagctggtgcggcggccccccgaggtctttgagcaggagatcaggcaacactttagcactggtggctggcggctggtgaaccgtatcgagtcctggctggaaacccatgccctgctggagaaggcccaggcactgcccaacggggtgcccaaggccagcagctcgccagagcccccagctgtagccgagctgtcagactccggccaacaagaacctgaggatggagggccagccccaggagaggcctcccagggctcagactcagagggcggtgcccagagcctggcctcagctagcagggaccacacagaccagacttcggagaccgcaccagacgcatcggtgccacccagtgtgaaaccaaagaagcggagaaagagctaccggagcttcttacctgagaagagtggctaccctgacatcggcttccccctcttcccactttccaagggtttcatcaagagcatccggggtgtcctgacgcagttccgggctgccctgctagaggcaggcatgccggagtgcacagaggacaagtag
Sequence Length
1401
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
141,293 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2O, mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 O
NCBI Official Symbol
UBE2O
NCBI Official Synonym Symbols
E2-230K
NCBI Protein Information
(E3-independent) E2 ubiquitin-conjugating enzyme
UniProt Protein Name
(E3-independent) E2 ubiquitin-conjugating enzyme
Protein Family
UniProt Gene Name
UBE2O
UniProt Synonym Gene Names
KIAA1734; Ubiquitin-conjugating enzyme E2-230K
UniProt Entry Name
UBE2O_HUMAN
Uniprot Description
UBE2O: Catalyzes the covalent attachment of ubiquitin to other proteins. Belongs to the ubiquitin-conjugating enzyme family.
Protein type: Ligase; Ubiquitin conjugating system; EC 6.3.2.19; Ubiquitin ligase
Chromosomal Location of Human Ortholog: 17q25.1
Cellular Component: cytoplasm; nucleus
Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity
Biological Process: positive regulation of BMP signaling pathway; protein monoubiquitination; retrograde transport, endosome to Golgi
Research Articles on UBE2O
Similar Products
Product Notes
The UBE2O ube2o (Catalog #AAA1267826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgtgg agcagctgct gacgggctcg cccacctctc cgactgtgga gcctgagaag ccaactcggg agaagaagtt tctggatgac atcaagaagc tacaggaaaa cctcaagaag accctggaca atgtggccat tgtagaggag gagaagatgg aagcagtgcc cgacgtagag cgcaaggagg acaagcccga ggggcagtca cctgtgaagg ctgagtggcc cagcgaaacc ccggtgctgt gccagcagtg tggcggcaag cctggcgtca ccttcaccag cgccaagggc gaggtcttct ccgtactgga gtttgcaccc tcaaatcatt cttttaagaa aattgagttc cagcctccag aagccaagaa gttcttcagc acagtgcgga aggagatggc gctgctggct acctcactgc ctgagggcat catggtcaag acttttgaag atagaatgga cctcttctca gctctcatca agggccccac tcgaaccccc tacgaggatg gcctctactt gtttgacatc cagctcccca acatctaccc agccgtgccc ccccacttct gctacctctc ccaatgcagt ggccgcctga accccaacct gtatgacaat gggaaggtgt gtgtcagcct cctgggcacc tgtattggaa aggggacaga gaggtggaca agcaagtcca gccttctcca ggtgctcatc tccatccaag gtctgatcct ggtaaatgaa ccatactaca acgaagccgg cttcgacagt gaccgaggcc tgcaggaagg ctatgaaaac agtcgctgtt acaatgagat ggcgctgatc cgcgtggtgc agtccatgac ccagctggtg cggcggcccc ccgaggtctt tgagcaggag atcaggcaac actttagcac tggtggctgg cggctggtga accgtatcga gtcctggctg gaaacccatg ccctgctgga gaaggcccag gcactgccca acggggtgcc caaggccagc agctcgccag agcccccagc tgtagccgag ctgtcagact ccggccaaca agaacctgag gatggagggc cagccccagg agaggcctcc cagggctcag actcagaggg cggtgcccag agcctggcct cagctagcag ggaccacaca gaccagactt cggagaccgc accagacgca tcggtgccac ccagtgtgaa accaaagaag cggagaaaga gctaccggag cttcttacct gagaagagtg gctaccctga catcggcttc cccctcttcc cactttccaa gggtttcatc aagagcatcc ggggtgtcct gacgcagttc cgggctgccc tgctagaggc aggcatgccg gagtgcacag aggacaagta g. It is sometimes possible for the material contained within the vial of "UBE2O, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
