Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FOXRED2 cdna clone

FOXRED2 cDNA Clone

Gene Names
FOXRED2; ERFAD
Synonyms
FOXRED2; FOXRED2 cDNA Clone; FOXRED2 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcctctccgctgcggccccgttgtggggtcccccggggctgctcctggccatcgccctgcacccagcgctgtcggtgcccccgcgccgggactactgcgtgctgggcgctgggcccgcgggcctgcagatggcctacttcctgcagcgcgctggacgcgactacgcagtgttcgagcgggccccgcggcccggcagcttcttcacacgctacccgcggcaccgcaagctcatcagcatcaacaagcggtacacgggcaaggctaacgccgagttcaacctccgccacgactggaactctctgctcagccacgacccccggctgctcttcagacactactcgcgtgcctacttccccgacgcccgcgacatggtgcgctacctgggtgacttcgcggacacgctggggctccgtgtccagtacaacaccaccatcgcccacgtcactctggacaaggaccgacaggcctggaatggccactacttcatcctaactgaccagaagggccaggtgcatcagtgcagcgtcctccttgtagccactggtttatcagtccccaaccaggttgacttccctggctccgaatatgcagagggttacgagtccgtgtccgtggaccctgaggactttgtaggccagaatgtgctgatcctgggtcgtgggaactcggcctttgagacagcagagaacatcttgggtgtcacaaactttatccatatgctcagccgctcccgggtccgtctgtcctgggccacccactacgttggagacctcagagccatcaacaatggcctgctggatacctaccagctcaagtccctggacgggctgctcgagtctgacctgacggatctggccatcctgaaggacagcaaaggcaagttccatgtcaccccgaaattcttcctggaagaagccagcaccaaccagagtgccgactccatcaccctcccccaggacgacaatgacaactttgccatgcgcgtgccctatgaccgggtaatccgctgcctgggctggaactttgacttctccattttcaataagtccctcagacttaactcgggaaatgcgttcggcaagaagtacccgctgattcgagctagctacgaatccaaaggaagccggggtctgtttatcctgggtactgccagccactcggtggactaccggaaatctgctgggggcttcatccacggattccgatacacagtgcgtgctgttcaccggctcctggagcaccgccaccacagcgtcacctggcccgccactgagctccccatcacacagctgaccagctccatcgtgcggcgcgtgaatgaggcttctgggctctaccagatgttcggtgtgctggccgatgtcatcctgttgaaggagaattccacggcctttgagtacctggaggagttccccatacagatgctggcccagctggagacactcacagggaggaaggcaaagcacgggctcttcgtcatcaacatggaatatggcagaaatttctctggccccgacaaggacgtcttctttgatgaccggtctgtggggcacacagaagatgcctggcagtctaactttcttcatcctgtcatctactactatagatacctccccaccgaacaggaggtgaggttccgccctgcacactggcccctgcctcggcccacggccatccatcacatcgtggaagacttcttaacagactggactgccccgatcgggcacatcctacctctgaggcgcttcctggagaactgtttggacaccgatttgcgaagcttctatgcagagtcctgcttcctgttcgccctcacgcgccagaagttgccacccttttgccagcaggggtacctgaggatgcagggactcgtgagtaccgagagcctttggcagcacagagtggagagcaggctcctgcgggactatgcccccacaggcaggcgcctggaggacagcagccagcagcttggcgaccaagagccactaggttcccccctggctccagggcctctggctcagtccgtcgatagcaacaaagaggagctctga
Sequence Length
2055
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,157 Da
NCBI Official Full Name
Homo sapiens FAD-dependent oxidoreductase domain containing 2, mRNA
NCBI Official Synonym Full Names
FAD dependent oxidoreductase domain containing 2
NCBI Official Symbol
FOXRED2
NCBI Official Synonym Symbols
ERFAD
NCBI Protein Information
FAD-dependent oxidoreductase domain-containing protein 2
UniProt Protein Name
FAD-dependent oxidoreductase domain-containing protein 2
UniProt Gene Name
FOXRED2
UniProt Synonym Gene Names
ERFAD
UniProt Entry Name
FXRD2_HUMAN

Uniprot Description

FOXRED2: Probable flavoprotein which may function in endoplasmic reticulum associated degradation (ERAD). May bind non-native proteins in the endoplasmic reticulum and target them to the ubiquitination machinery for subsequent degradation. Belongs to the FOXRED2 family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 22q12.3

Cellular Component: endoplasmic reticulum lumen

Molecular Function: FAD binding; glycoprotein binding; monooxygenase activity; protein binding

Biological Process: ER-associated protein catabolic process

Research Articles on FOXRED2

Similar Products

Product Notes

The FOXRED2 foxred2 (Catalog #AAA1267271) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcctct ccgctgcggc cccgttgtgg ggtcccccgg ggctgctcct ggccatcgcc ctgcacccag cgctgtcggt gcccccgcgc cgggactact gcgtgctggg cgctgggccc gcgggcctgc agatggccta cttcctgcag cgcgctggac gcgactacgc agtgttcgag cgggccccgc ggcccggcag cttcttcaca cgctacccgc ggcaccgcaa gctcatcagc atcaacaagc ggtacacggg caaggctaac gccgagttca acctccgcca cgactggaac tctctgctca gccacgaccc ccggctgctc ttcagacact actcgcgtgc ctacttcccc gacgcccgcg acatggtgcg ctacctgggt gacttcgcgg acacgctggg gctccgtgtc cagtacaaca ccaccatcgc ccacgtcact ctggacaagg accgacaggc ctggaatggc cactacttca tcctaactga ccagaagggc caggtgcatc agtgcagcgt cctccttgta gccactggtt tatcagtccc caaccaggtt gacttccctg gctccgaata tgcagagggt tacgagtccg tgtccgtgga ccctgaggac tttgtaggcc agaatgtgct gatcctgggt cgtgggaact cggcctttga gacagcagag aacatcttgg gtgtcacaaa ctttatccat atgctcagcc gctcccgggt ccgtctgtcc tgggccaccc actacgttgg agacctcaga gccatcaaca atggcctgct ggatacctac cagctcaagt ccctggacgg gctgctcgag tctgacctga cggatctggc catcctgaag gacagcaaag gcaagttcca tgtcaccccg aaattcttcc tggaagaagc cagcaccaac cagagtgccg actccatcac cctcccccag gacgacaatg acaactttgc catgcgcgtg ccctatgacc gggtaatccg ctgcctgggc tggaactttg acttctccat tttcaataag tccctcagac ttaactcggg aaatgcgttc ggcaagaagt acccgctgat tcgagctagc tacgaatcca aaggaagccg gggtctgttt atcctgggta ctgccagcca ctcggtggac taccggaaat ctgctggggg cttcatccac ggattccgat acacagtgcg tgctgttcac cggctcctgg agcaccgcca ccacagcgtc acctggcccg ccactgagct ccccatcaca cagctgacca gctccatcgt gcggcgcgtg aatgaggctt ctgggctcta ccagatgttc ggtgtgctgg ccgatgtcat cctgttgaag gagaattcca cggcctttga gtacctggag gagttcccca tacagatgct ggcccagctg gagacactca cagggaggaa ggcaaagcac gggctcttcg tcatcaacat ggaatatggc agaaatttct ctggccccga caaggacgtc ttctttgatg accggtctgt ggggcacaca gaagatgcct ggcagtctaa ctttcttcat cctgtcatct actactatag atacctcccc accgaacagg aggtgaggtt ccgccctgca cactggcccc tgcctcggcc cacggccatc catcacatcg tggaagactt cttaacagac tggactgccc cgatcgggca catcctacct ctgaggcgct tcctggagaa ctgtttggac accgatttgc gaagcttcta tgcagagtcc tgcttcctgt tcgccctcac gcgccagaag ttgccaccct tttgccagca ggggtacctg aggatgcagg gactcgtgag taccgagagc ctttggcagc acagagtgga gagcaggctc ctgcgggact atgcccccac aggcaggcgc ctggaggaca gcagccagca gcttggcgac caagagccac taggttcccc cctggctcca gggcctctgg ctcagtccgt cgatagcaac aaagaggagc tctga. It is sometimes possible for the material contained within the vial of "FOXRED2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.