TTLL1 cdna clone
TTLL1 cDNA Clone
Gene Names
TTLL1; C22orf7; HS323M22B
Synonyms
TTLL1; TTLL1 cDNA Clone; TTLL1 cdna clone
Sequence
atggcagggaaagtaaaatgggtcactgatatcgagaagtcagtgctgatcaataactttgaaaagagaggatgggtccaagtgacagaaaacgaggactggaatttttactggatgagtgtgcaaaccatccgaaatgtgttcagcgttgaagctggatatcggctctcagatgaccaaatagtcaaccattttccaaaccactatgaactgacccggaaggacctgatggtgaagaacatcaaaagatacaggaaggagctggagaaagaagggagtcctctggcagaaaaagatgaaaatggaaaatacctctatctggactttgttccagtcacctatatgctgcccgctgactacaacctgtttgtagaggagttccggaagagcccgtccagcacctggatcatgaagccttgtggcaaggcccagggaaagggcatcttccttatcaacaagctctcacagatcaaaaagtggtcccgggacagcaagacatcttcgtttgtgtctcaatctaataaggaagcctacgtgatctctctctatattaacaacccgttactaattggcgggaggaagttcgacctgcgcttgtacgttctggtgtccacgtaccgtccactgcgctgttacatgtacaagcttgggttttgccggttctgcacagtgaaatacaccccgagtaccagtgagctggacaacatgttcgttcatctcaccaacgtcgccatccagaaacacggggaggactacaaccacatccatgggggcaagtggacagtgagtaacctgcggctctacctggagagcacccgcggcaaggaggtgaccagcaagctgttcgacgagatccactggatcatcgtgcagtccctgaaggctgtggcgccggtgatgaacaatgacaagcactgctttgaatgctatggctacgacatcatcatcgacgacaagctgaagccctggctgatcgaggtgaatgcgtccccgtctctcacgtccagcactgccaatgaccgaatcctcaagtacaacctgattaatgacaccctcaacatcgccgtcccgaatggtgaaatcccagactgcaaatggaacaagtcgccacctaaggaagtcctcggcaattacgagattctgtatgatgaagaattggcccagggtgacggggctgaccgggagctgagaagccgtcagggtcagtctctggggcccagagcaggccgatcgagagactcggggagagcggtcctcaccacctggaagtga
Sequence Length
1272
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,493 Da
NCBI Official Full Name
Homo sapiens tubulin tyrosine ligase-like family, member 1, mRNA
NCBI Official Synonym Full Names
tubulin tyrosine ligase like 1
NCBI Official Symbol
TTLL1
NCBI Official Synonym Symbols
C22orf7; HS323M22B
NCBI Protein Information
probable tubulin polyglutamylase TTLL1
UniProt Protein Name
Probable tubulin polyglutamylase TTLL1
Protein Family
UniProt Gene Name
TTLL1
UniProt Synonym Gene Names
C22orf7; PGs3
UniProt Entry Name
TTLL1_HUMAN
Uniprot Description
TTLL1: Catalytic subunit of the neuronal tubulin polyglutamylase complex. Modifies alpha- and beta-tubulin, generating side chains of glutamate on the gamma-carboxyl groups of specific glutamate residues within the C-terminal tail of alpha- and beta-tubulin. Belongs to the tubulin polyglutamylase family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Microtubule-binding; Cell cycle regulation; EC 6.-.-.-; Ligase
Chromosomal Location of Human Ortholog: 22q13.1
Biological Process: protein polyglutamylation
Research Articles on TTLL1
Similar Products
Product Notes
The TTLL1 ttll1 (Catalog #AAA1267249) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggga aagtaaaatg ggtcactgat atcgagaagt cagtgctgat caataacttt gaaaagagag gatgggtcca agtgacagaa aacgaggact ggaattttta ctggatgagt gtgcaaacca tccgaaatgt gttcagcgtt gaagctggat atcggctctc agatgaccaa atagtcaacc attttccaaa ccactatgaa ctgacccgga aggacctgat ggtgaagaac atcaaaagat acaggaagga gctggagaaa gaagggagtc ctctggcaga aaaagatgaa aatggaaaat acctctatct ggactttgtt ccagtcacct atatgctgcc cgctgactac aacctgtttg tagaggagtt ccggaagagc ccgtccagca cctggatcat gaagccttgt ggcaaggccc agggaaaggg catcttcctt atcaacaagc tctcacagat caaaaagtgg tcccgggaca gcaagacatc ttcgtttgtg tctcaatcta ataaggaagc ctacgtgatc tctctctata ttaacaaccc gttactaatt ggcgggagga agttcgacct gcgcttgtac gttctggtgt ccacgtaccg tccactgcgc tgttacatgt acaagcttgg gttttgccgg ttctgcacag tgaaatacac cccgagtacc agtgagctgg acaacatgtt cgttcatctc accaacgtcg ccatccagaa acacggggag gactacaacc acatccatgg gggcaagtgg acagtgagta acctgcggct ctacctggag agcacccgcg gcaaggaggt gaccagcaag ctgttcgacg agatccactg gatcatcgtg cagtccctga aggctgtggc gccggtgatg aacaatgaca agcactgctt tgaatgctat ggctacgaca tcatcatcga cgacaagctg aagccctggc tgatcgaggt gaatgcgtcc ccgtctctca cgtccagcac tgccaatgac cgaatcctca agtacaacct gattaatgac accctcaaca tcgccgtccc gaatggtgaa atcccagact gcaaatggaa caagtcgcca cctaaggaag tcctcggcaa ttacgagatt ctgtatgatg aagaattggc ccagggtgac ggggctgacc gggagctgag aagccgtcag ggtcagtctc tggggcccag agcaggccga tcgagagact cggggagagc ggtcctcacc acctggaagt ga. It is sometimes possible for the material contained within the vial of "TTLL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
