ZNF350 cdna clone
ZNF350 cDNA Clone
Gene Names
ZNF350; ZFQR; ZBRK1
Synonyms
ZNF350; ZNF350 cDNA Clone; ZNF350 cdna clone
Sequence
atgatccaggcccaggaatccataacactggaggatgtggctgtggacttcacttgggaggagtggcaactcctgggcgctgctcagaaggacctgtaccgggacgtgatgttggagaactacagcaacctggtggcagtggggtatcaagccagcaaaccggatgcactcttcaagttggaacaaggagaacaactgtggacaattgaagatggaatccacagtggagcctgttcagacatatggaaagttgatcatgtgctggagcgcttgcagagtgaaagcctggtgaacagaaggaaaccatgtcatgaacatgatgcatttgaaaatattgttcattgcagcaaaagtcagtttctgttagggcaaaatcatgatatatttgacttacgtggaaaaagtttgaaatccaatttaactttagttaaccagagcaaaggctatgaaataaagaactctgttgagtttactggaaatggggactcctttcttcatgctaaccatgaacgacttcatactgcaattaaattccctgcaagtcaaaaactcatcagcactaagtcccaattcatcagtcccaagcatcagaaaacacgaaaattagagaagcatcatgtgtgcagtgaatgtgggaaagccttcatcaagaagtcttggctaactgatcaccaggtaatgcatacaggagagaaaccccacagatgtagtctatgtgagaaagccttctccagaaagttcatgcttactgaacatcagcgaactcatacaggagaaaaaccttatgaatgccctgaatgtggcaaagcctttctcaagaaatcacggctcaacatacatcagaaaacacataccggagagaaaccctatatatgcagtgaatgtggaaaaggcttcatccagaaaggaaatctcattgtacaccagcgaattcatacaggtgagaaaccttatatatgcaatgaatgtggaaaaggcttcattcagaagacgtgtctcatagcacatcagagatttcacacaggaaagacgccctttgtgtgcagtgaatgtggaaaatcctgttctcagaaatcaggtctcattaaacatcaaagaattcacacaggagagaaaccctttgaatgtagtgaatgtgggaaagcctttagcacaaagcaaaagctcattgtccatcaaaggactcatacaggagagagaccctatggctgtaacgagtgtgggaaagcgtttgcgtatatgtcgtgtctggttaagcataagagaatacacacaagggagaaacaagaggcagccaaggtggaaaatcctcctgcagagaggcacagctcattacacaccagtgatgtcatgcaggagaaaaactctgctaacggggcgactacacaagtgccttctgtggcccctcagacatcattaaacatcagcggcctcctcgcaaacaggaacgtagtccttgtgggacagccagtggtcagatgtgcagcctcaggagataacagaggatttgcacaggacagaaaccttgtgaatgcagtgaatgtggttgtgccttccgtgatcaattatgtcttattttatgttacagaaaacccatag
Sequence Length
1599
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
60,011 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 350, mRNA
NCBI Official Synonym Full Names
zinc finger protein 350
NCBI Official Symbol
ZNF350
NCBI Official Synonym Symbols
ZFQR; ZBRK1
NCBI Protein Information
zinc finger protein 350
UniProt Protein Name
Zinc finger protein 350
Protein Family
UniProt Gene Name
ZNF350
UniProt Synonym Gene Names
ZBRK1
UniProt Entry Name
ZN350_HUMAN
Uniprot Description
ZNF350: Transcriptional repressor. Binds to a specific sequence, 5'-GGGxxxCAGxxxTTT-3', within GADD45 intron 3. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: Transcription factor; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 19q13.41
Cellular Component: nucleoplasm; nucleus; transcriptional repressor complex
Molecular Function: DNA binding; protein binding
Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent
Research Articles on ZNF350
Similar Products
Product Notes
The ZNF350 znf350 (Catalog #AAA1266955) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatccagg cccaggaatc cataacactg gaggatgtgg ctgtggactt cacttgggag gagtggcaac tcctgggcgc tgctcagaag gacctgtacc gggacgtgat gttggagaac tacagcaacc tggtggcagt ggggtatcaa gccagcaaac cggatgcact cttcaagttg gaacaaggag aacaactgtg gacaattgaa gatggaatcc acagtggagc ctgttcagac atatggaaag ttgatcatgt gctggagcgc ttgcagagtg aaagcctggt gaacagaagg aaaccatgtc atgaacatga tgcatttgaa aatattgttc attgcagcaa aagtcagttt ctgttagggc aaaatcatga tatatttgac ttacgtggaa aaagtttgaa atccaattta actttagtta accagagcaa aggctatgaa ataaagaact ctgttgagtt tactggaaat ggggactcct ttcttcatgc taaccatgaa cgacttcata ctgcaattaa attccctgca agtcaaaaac tcatcagcac taagtcccaa ttcatcagtc ccaagcatca gaaaacacga aaattagaga agcatcatgt gtgcagtgaa tgtgggaaag ccttcatcaa gaagtcttgg ctaactgatc accaggtaat gcatacagga gagaaacccc acagatgtag tctatgtgag aaagccttct ccagaaagtt catgcttact gaacatcagc gaactcatac aggagaaaaa ccttatgaat gccctgaatg tggcaaagcc tttctcaaga aatcacggct caacatacat cagaaaacac ataccggaga gaaaccctat atatgcagtg aatgtggaaa aggcttcatc cagaaaggaa atctcattgt acaccagcga attcatacag gtgagaaacc ttatatatgc aatgaatgtg gaaaaggctt cattcagaag acgtgtctca tagcacatca gagatttcac acaggaaaga cgccctttgt gtgcagtgaa tgtggaaaat cctgttctca gaaatcaggt ctcattaaac atcaaagaat tcacacagga gagaaaccct ttgaatgtag tgaatgtggg aaagccttta gcacaaagca aaagctcatt gtccatcaaa ggactcatac aggagagaga ccctatggct gtaacgagtg tgggaaagcg tttgcgtata tgtcgtgtct ggttaagcat aagagaatac acacaaggga gaaacaagag gcagccaagg tggaaaatcc tcctgcagag aggcacagct cattacacac cagtgatgtc atgcaggaga aaaactctgc taacggggcg actacacaag tgccttctgt ggcccctcag acatcattaa acatcagcgg cctcctcgca aacaggaacg tagtccttgt gggacagcca gtggtcagat gtgcagcctc aggagataac agaggatttg cacaggacag aaaccttgtg aatgcagtga atgtggttgt gccttccgtg atcaattatg tcttatttta tgttacagaa aacccatag. It is sometimes possible for the material contained within the vial of "ZNF350, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
