Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PAK4 cdna clone

PAK4 cDNA Clone

Synonyms
PAK4; PAK4 cDNA Clone; PAK4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttgggaagaggaagaagcgggtggagatctccgcgccgtccaacttcgagcaccgcgtgcacacgggcttcgaccagcacgagcagaagttcacggggctgccccgccagtggcagagcctgatcgaggagtcggctcgccggcccaagcccctcgtcgaccccgcctgcatcacctccatccagcccggggcccccaagaccatcgtgcggggcagcaaaggtgccaaagatggggccctcacgctgctgctggacgagtttgagaacatgtcggtgacacgctccaactccctgcggagagacagcccgccgccgcccgcccgtgcccgccaggaaaatgggatgccagaaaagccccctggcccccgctcaccacagcgggagccacagcgagtatcccatgagcagttccgggctgccctgcagctggtggtggacccaggcgacccccgctcctacctggacaacttcatcaagattggcgagggctccacgggcatcgtgtgcatcgccaccgtgcgcagctcgggcaagctggtggccgtcaagaagatggacctgcgcaagcagcagaggcgcgagctgctcttcaacgaggtggtaatcatgagggactaccagcacgagaatgtggtggagatgtacaacagctacctggtgggggacgagctctgggtggtcatggagttcctggaaggaggcgccctcaccgacatcgtcacccacaccaggatgaacgaggagcagatcgcggccgtgtgccttgcagtgctgcaggccctgtcggtgctccacgcccagggcgtcatccaccgggacatcaagagcgactcgatcctgctgacccatgatggcagggtgaagctgtcagactttgggttctgcgcccaggtgagcaaggaagtgccccgaaggaagtcgctggtcggcacgccctactggatggccccagagctcatctcccgccttccctacgggccagaggtagacatctggtcgctggggataatggtgattgagatggtggacggagagcccccctacttcaacgagccacccctcaaagccatgaagatgattcgggacaacctgccaccccgactgaagaacctgcacaaggtgtcgccatccctgaagggcttcctggaccgcctgctggtgcgagaccctgcccagcgggccacggcagccgagctgctgaagcacccattcctggccaaggcagggccgcctgccagcatcgtgcccctcatgcgccagaaccgcaccagatga
Sequence Length
1281
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,940 Da
NCBI Official Full Name
Homo sapiens p21 protein (Cdc42/Rac)-activated kinase 4, mRNA
NCBI Official Synonym Full Names
p21 (RAC1) activated kinase 4
NCBI Official Symbol
PAK4
NCBI Protein Information
serine/threonine-protein kinase PAK 4
UniProt Protein Name
Serine/threonine-protein kinase PAK 4
UniProt Gene Name
PAK4
UniProt Synonym Gene Names
KIAA1142; PAK-4
UniProt Entry Name
PAK4_HUMAN

NCBI Description

PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

PAK4: a protein kinase of the STE20 family. A mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Interacts specifically with the GTP-bound form of Cdc42 and weakly activates the JNK family of MAP kinases. Overexpressed in several cancers. Required for ras-dependent anchorage-independent growth of tumor cell lines. Four alternatively spliced human isoforms have been reported.

Protein type: Protein kinase, STE; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; STE group; STE20 family; PAKB subfamily

Chromosomal Location of Human Ortholog: 19q13.2

Cellular Component: cell-cell adherens junction; focal adhesion; Golgi apparatus

Molecular Function: protein binding; receptor signaling protein serine/threonine kinase activity

Biological Process: apoptosis; cell growth; cell migration; cell motility; cell proliferation; cytoskeleton organization and biogenesis; mitotic cell cycle; signal transduction

Research Articles on PAK4

Similar Products

Product Notes

The PAK4 pak4 (Catalog #AAA1266670) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttggga agaggaagaa gcgggtggag atctccgcgc cgtccaactt cgagcaccgc gtgcacacgg gcttcgacca gcacgagcag aagttcacgg ggctgccccg ccagtggcag agcctgatcg aggagtcggc tcgccggccc aagcccctcg tcgaccccgc ctgcatcacc tccatccagc ccggggcccc caagaccatc gtgcggggca gcaaaggtgc caaagatggg gccctcacgc tgctgctgga cgagtttgag aacatgtcgg tgacacgctc caactccctg cggagagaca gcccgccgcc gcccgcccgt gcccgccagg aaaatgggat gccagaaaag ccccctggcc cccgctcacc acagcgggag ccacagcgag tatcccatga gcagttccgg gctgccctgc agctggtggt ggacccaggc gacccccgct cctacctgga caacttcatc aagattggcg agggctccac gggcatcgtg tgcatcgcca ccgtgcgcag ctcgggcaag ctggtggccg tcaagaagat ggacctgcgc aagcagcaga ggcgcgagct gctcttcaac gaggtggtaa tcatgaggga ctaccagcac gagaatgtgg tggagatgta caacagctac ctggtggggg acgagctctg ggtggtcatg gagttcctgg aaggaggcgc cctcaccgac atcgtcaccc acaccaggat gaacgaggag cagatcgcgg ccgtgtgcct tgcagtgctg caggccctgt cggtgctcca cgcccagggc gtcatccacc gggacatcaa gagcgactcg atcctgctga cccatgatgg cagggtgaag ctgtcagact ttgggttctg cgcccaggtg agcaaggaag tgccccgaag gaagtcgctg gtcggcacgc cctactggat ggccccagag ctcatctccc gccttcccta cgggccagag gtagacatct ggtcgctggg gataatggtg attgagatgg tggacggaga gcccccctac ttcaacgagc cacccctcaa agccatgaag atgattcggg acaacctgcc accccgactg aagaacctgc acaaggtgtc gccatccctg aagggcttcc tggaccgcct gctggtgcga gaccctgccc agcgggccac ggcagccgag ctgctgaagc acccattcct ggccaaggca gggccgcctg ccagcatcgt gcccctcatg cgccagaacc gcaccagatg a. It is sometimes possible for the material contained within the vial of "PAK4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.