Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRCC2 cdna clone

XRCC2 cDNA Clone

Gene Names
XRCC2; FANCU
Synonyms
XRCC2; XRCC2 cDNA Clone; XRCC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtagtgccttccatagggctgagtctgggaccgagctccttgcccgacttgaaggtagaagttccttgaaagaaatagaaccaaatctgtttgctgatgaagattcacctgtgcatggtgatattcttgaatttcatggcccagaaggaacaggaaaaacagaaatgctttatcacctaacagcacgatgtatacttcccaaatcagaaggtggcctggaagtagaagtcttatttattgatacagattaccactttgatatgctccggctagttacaattcttgagcacagactatcccaaagctctgaagaaataatcaaatactgcctgggaagattttttttggtgtactgcagtagtagcacccacttacttcttacactttactcactagaaagtatgttttgtagtcacccatctctctgccttttgattttggatagcctgtcagctttttactggatagaccgcgtcaatggaggagaaagtgtgaacttacaggagtctactctgaggaaatgttctcagtgcttagagaagcttgtaaatgactatcgcctggttctttttgcaacgacacaaactataatgcagaaagcctcgagctcatcagaagaaccttctcatgcctctcgacgactgtgtgatgtggacatagactacagaccttatctctgtaaggcatggcagcaactggtgaagcacaggatgtttttctccaaacaagatgattctcaaagcagcaaccaattttcattagtttcacgttgtttaaaaagtaacagtttaaaaaaacatttttttattattggagaaagtggggttgaattttgttga
Sequence Length
843
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,956 Da
NCBI Official Full Name
Homo sapiens X-ray repair complementing defective repair in Chinese hamster cells 2, mRNA
NCBI Official Synonym Full Names
X-ray repair cross complementing 2
NCBI Official Symbol
XRCC2
NCBI Official Synonym Symbols
FANCU
NCBI Protein Information
DNA repair protein XRCC2
UniProt Protein Name
DNA repair protein XRCC2
Protein Family
UniProt Gene Name
XRCC2
UniProt Entry Name
XRCC2_HUMAN

NCBI Description

This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene is involved in the repair of DNA double-strand breaks by homologous recombination and it functionally complements Chinese hamster irs1, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents. [provided by RefSeq, Jul 2008]

Uniprot Description

XRCC2: Involved in the homologous recombination repair (HRR) pathway of double-stranded DNA, thought to repair chromosomal fragmentation, translocations and deletions. The BCDX2 complex binds single-stranded DNA, single-stranded gaps in duplex DNA and specifically to nicks in duplex DNA. Belongs to the RecA family. RAD51 subfamily.

Chromosomal Location of Human Ortholog: 7q36.1

Cellular Component: centrosome; nucleoplasm; replication fork

Molecular Function: DNA-dependent ATPase activity; double-stranded DNA binding; endodeoxyribonuclease activity; four-way junction DNA binding; protein binding; recombinase activity; single-stranded DNA binding

Biological Process: centrosome organization and biogenesis; DNA repair; DNA synthesis during DNA repair; double-strand break repair via homologous recombination; meiosis; meiotic DNA recombinase assembly; meiotic recombination; mitotic cell cycle; mitotic recombination; response to ionizing radiation; strand displacement; strand invasion

Research Articles on XRCC2

Similar Products

Product Notes

The XRCC2 xrcc2 (Catalog #AAA1266621) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtagtg ccttccatag ggctgagtct gggaccgagc tccttgcccg acttgaaggt agaagttcct tgaaagaaat agaaccaaat ctgtttgctg atgaagattc acctgtgcat ggtgatattc ttgaatttca tggcccagaa ggaacaggaa aaacagaaat gctttatcac ctaacagcac gatgtatact tcccaaatca gaaggtggcc tggaagtaga agtcttattt attgatacag attaccactt tgatatgctc cggctagtta caattcttga gcacagacta tcccaaagct ctgaagaaat aatcaaatac tgcctgggaa gatttttttt ggtgtactgc agtagtagca cccacttact tcttacactt tactcactag aaagtatgtt ttgtagtcac ccatctctct gccttttgat tttggatagc ctgtcagctt tttactggat agaccgcgtc aatggaggag aaagtgtgaa cttacaggag tctactctga ggaaatgttc tcagtgctta gagaagcttg taaatgacta tcgcctggtt ctttttgcaa cgacacaaac tataatgcag aaagcctcga gctcatcaga agaaccttct catgcctctc gacgactgtg tgatgtggac atagactaca gaccttatct ctgtaaggca tggcagcaac tggtgaagca caggatgttt ttctccaaac aagatgattc tcaaagcagc aaccaatttt cattagtttc acgttgttta aaaagtaaca gtttaaaaaa acattttttt attattggag aaagtggggt tgaattttgt tga. It is sometimes possible for the material contained within the vial of "XRCC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.