Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCOC cdna clone

SCOC cDNA Clone

Gene Names
SCOC; SCOCO; UNC-69; HRIHFB2072
Synonyms
SCOC; SCOC cDNA Clone; SCOC cdna clone
Ordering
For Research Use Only!
Sequence
atggacgggtccaggaaagaggaggaggaagacagcacattcaccaacatttctcttgcagatgacatagaccattcctcaagaattttgtatccaaggcccaaaagtttgttacccaagatgatgaatgctgacatggatgttgatgctgaaaatcaagtggaactggaggaaaaaacaagacttattaatcaagtgttggaactccaacacacacttgaagatctctctgcaagagtagatgcagttaaggaagaaaatctgaagctaaaatcagaaaaccaagttcttggacaatatatagaaaatctcatgtcagcttctagtgtttttcaaacaactgacacaaaaagcaaaagaaagtaa
Sequence Length
366
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,801 Da
NCBI Official Full Name
Homo sapiens short coiled-coil protein, mRNA
NCBI Official Synonym Full Names
short coiled-coil protein
NCBI Official Symbol
SCOC
NCBI Official Synonym Symbols
SCOCO; UNC-69; HRIHFB2072
NCBI Protein Information
short coiled-coil protein
UniProt Protein Name
Short coiled-coil protein
Protein Family
UniProt Gene Name
SCOC
UniProt Synonym Gene Names
SCOCO
UniProt Entry Name
SCOC_HUMAN

NCBI Description

This gene encodes a short coiled-coiled domain-containing protein that localizes to the Golgi apparatus. The encoded protein interacts with ADP-ribosylation factor-like proteins. Pseudogenes of this gene are found on chromosomes 1 and 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]

Uniprot Description

SCOC: Positive regulator of amino acid starvation-induced autophagy. Belongs to the SCOC family. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 4q31.1

Cellular Component: cytosol; endosome; trans-Golgi network

Molecular Function: protein binding

Biological Process: positive regulation of macroautophagy

Research Articles on SCOC

Similar Products

Product Notes

The SCOC scoc (Catalog #AAA1266530) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgggt ccaggaaaga ggaggaggaa gacagcacat tcaccaacat ttctcttgca gatgacatag accattcctc aagaattttg tatccaaggc ccaaaagttt gttacccaag atgatgaatg ctgacatgga tgttgatgct gaaaatcaag tggaactgga ggaaaaaaca agacttatta atcaagtgtt ggaactccaa cacacacttg aagatctctc tgcaagagta gatgcagtta aggaagaaaa tctgaagcta aaatcagaaa accaagttct tggacaatat atagaaaatc tcatgtcagc ttctagtgtt tttcaaacaa ctgacacaaa aagcaaaaga aagtaa. It is sometimes possible for the material contained within the vial of "SCOC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.