TRPT1 cdna clone
TRPT1 cDNA Clone
Synonyms
TRPT1; TRPT1 cDNA Clone; TRPT1 cdna clone
Sequence
atgggagctgatggcttcgtgcccctgggcaccctcctgcagttgccccagttccgcggcttctctgctgaagatgtgcagcgcgtggtggacaccaataggaagcagcggttcgccctgcagctgggcgatcccagcactggccttctcatccgggccaaccagggccattccctgcaggtacctaagttggagctgatgcccctggagacaccgcaggccctgcccccgatgctagtccatggtacattctggaagcactggccatccatcctactcaaaggcctgtcctgccagggaaggacgcacattcacctggccccaggactgcctggagaccccggtatcatcagtggcatgcggtcccattgtgaaatagctgtgttcatcgatggacccctggctctggcagatggaatacccttcttccgctctgccaatggggtgattctgactccagggaatactgatggcttcctccttcccaagtacttcaaggaggccctgcagctacgccctacccgaaagcccctttccttggctggtgatgaagagacagagtgtcagagtagccccaagcacagctccagagaaaggaggaggatccaacaataa
Sequence Length
615
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,898 Da
NCBI Official Full Name
Homo sapiens tRNA phosphotransferase 1, mRNA
NCBI Official Synonym Full Names
tRNA phosphotransferase 1
NCBI Official Symbol
TRPT1
NCBI Protein Information
tRNA 2'-phosphotransferase 1
UniProt Protein Name
tRNA 2'-phosphotransferase 1
Protein Family
UniProt Gene Name
TRPT1
UniProt Entry Name
TRPT1_HUMAN
Uniprot Description
TRPT1: Catalyzes the last step of tRNA splicing, the transfer of the splice junction 2'-phosphate from ligated tRNA to NAD to produce ADP-ribose 1''-2'' cyclic phosphate (Probable). Belongs to the KptA/TPT1 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transferase; EC 2.7.1.160
Chromosomal Location of Human Ortholog: 11q13.1
Similar Products
Product Notes
The TRPT1 trpt1 (Catalog #AAA1266220) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggagctg atggcttcgt gcccctgggc accctcctgc agttgcccca gttccgcggc ttctctgctg aagatgtgca gcgcgtggtg gacaccaata ggaagcagcg gttcgccctg cagctgggcg atcccagcac tggccttctc atccgggcca accagggcca ttccctgcag gtacctaagt tggagctgat gcccctggag acaccgcagg ccctgccccc gatgctagtc catggtacat tctggaagca ctggccatcc atcctactca aaggcctgtc ctgccaggga aggacgcaca ttcacctggc cccaggactg cctggagacc ccggtatcat cagtggcatg cggtcccatt gtgaaatagc tgtgttcatc gatggacccc tggctctggc agatggaata cccttcttcc gctctgccaa tggggtgatt ctgactccag ggaatactga tggcttcctc cttcccaagt acttcaagga ggccctgcag ctacgcccta cccgaaagcc cctttccttg gctggtgatg aagagacaga gtgtcagagt agccccaagc acagctccag agaaaggagg aggatccaac aataa. It is sometimes possible for the material contained within the vial of "TRPT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
