Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLNS1A cdna clone

CLNS1A cDNA Clone

Gene Names
CLNS1A; CLCI; ICln; CLNS1B
Synonyms
CLNS1A; CLNS1A cDNA Clone; CLNS1A cdna clone
Ordering
For Research Use Only!
Sequence
ATGAGCTTCCTCAAAAGTTTCCCGCCGCCTGGGCCAGCGGAGGGGCTCCTGCGGCAGCAGCCAGACACTGAGGCTGTGCTGAACGGGAAGGGCCTCGGCACTGGTACCCTTTACATCGCTGAGAGCCGCCTGTCTTGGTTAGATGGCTCTGGATTAGGATTCTCACTGGAATACCCCACCATTAGTTTACATGCATTATCCAGGGACCGAAGTGACTGTCTAGGAGAGCATTTGTATGTTATGGTGAATGCCAAATTTGAAGAAGAATCAAAAGAACCTGTTGCTGATGAAGAAGAGGAAGACAGTGATGATGATGTTGAACCTATTACTGAATTTAGATTTGTGCCTAGTGATAAATCAGCGTTGGAGGCAATGTTCACTGCAATGTGCGAATGCCAGGCCTTGCATCCAGATCCTGAGGATGAGGATTCAGATGACTACGATGGAGAAGAATATGATGTGGAAGCACATGAACAAGGACAGGGGGACATCCCTACATTTTACACCTATGAAGAAGGATTATCCCATCTAACAGCAGAAGGCCAAGCCACACTGGAGAGATTAGAAGGAATGCTTTCTCAGTCTGTGAGCAGCCAGTATAATATGGCTGGGGTCAGGACAGAAGATTCAATAAGAGATTATGAAGATGGGATGGAGGTGGATACCACACCAACAGTTGCTGGACAGTTTGAGGATGCAGATGTTGATCACTGA
Sequence Length
714
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,215 Da
NCBI Official Full Name
Homo sapiens chloride channel, nucleotide-sensitive, 1A, mRNA
NCBI Official Synonym Full Names
chloride nucleotide-sensitive channel 1A
NCBI Official Symbol
CLNS1A
NCBI Official Synonym Symbols
CLCI; ICln; CLNS1B
NCBI Protein Information
methylosome subunit pICln
UniProt Protein Name
Methylosome subunit pICln
UniProt Gene Name
CLNS1A
UniProt Synonym Gene Names
CLCI; ICLN; I(Cln); ClCI
UniProt Entry Name
ICLN_HUMAN

NCBI Description

This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

Uniprot Description

ICLN: The interaction with Sm proteins inhibits their assembly on U RNA and interferes with snRNP biogenesis. Inhibits the binding of survival motor neuron protein (SMN) to Sm proteins. May participate in cellular volume control by activation of a swelling-induced chloride conductance pathway. Belongs to the pICln (TC 1.A.47) family.

Protein type: Channel, chloride

Chromosomal Location of Human Ortholog: 11q13.5-q14

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: protein binding; protein heterodimerization activity

Biological Process: spliceosomal snRNP biogenesis

Research Articles on CLNS1A

Similar Products

Product Notes

The CLNS1A clns1a (Catalog #AAA1266133) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGAGCTTCC TCAAAAGTTT CCCGCCGCCT GGGCCAGCGG AGGGGCTCCT GCGGCAGCAG CCAGACACTG AGGCTGTGCT GAACGGGAAG GGCCTCGGCA CTGGTACCCT TTACATCGCT GAGAGCCGCC TGTCTTGGTT AGATGGCTCT GGATTAGGAT TCTCACTGGA ATACCCCACC ATTAGTTTAC ATGCATTATC CAGGGACCGA AGTGACTGTC TAGGAGAGCA TTTGTATGTT ATGGTGAATG CCAAATTTGA AGAAGAATCA AAAGAACCTG TTGCTGATGA AGAAGAGGAA GACAGTGATG ATGATGTTGA ACCTATTACT GAATTTAGAT TTGTGCCTAG TGATAAATCA GCGTTGGAGG CAATGTTCAC TGCAATGTGC GAATGCCAGG CCTTGCATCC AGATCCTGAG GATGAGGATT CAGATGACTA CGATGGAGAA GAATATGATG TGGAAGCACA TGAACAAGGA CAGGGGGACA TCCCTACATT TTACACCTAT GAAGAAGGAT TATCCCATCT AACAGCAGAA GGCCAAGCCA CACTGGAGAG ATTAGAAGGA ATGCTTTCTC AGTCTGTGAG CAGCCAGTAT AATATGGCTG GGGTCAGGAC AGAAGATTCA ATAAGAGATT ATGAAGATGG GATGGAGGTG GATACCACAC CAACAGTTGC TGGACAGTTT GAGGATGCAG ATGTTGATCA CTGA. It is sometimes possible for the material contained within the vial of "CLNS1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.