Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WTAP cdna clone

WTAP cDNA Clone

Gene Names
WTAP; Mum2
Synonyms
WTAP; WTAP cDNA Clone; WTAP cdna clone
Ordering
For Research Use Only!
Sequence
atgaccaacgaagaacctcttcccaagaaggttcgattgagtgaaacagacttcaaagttatggcaagagatgagttaattctaagatggaaacaatatgaagcatatgtacaagctttggagggcaagtacacagatcttaactctaatgatgtaactggcctaagagagtctgaagaaaaactaaagcaacaacagcaggagtctgcacgcagggaaaacatccttgtaatgcgactagcaaccaaggaacaagagatgcaagagtgtactactcaaatccagtacctcaagcaagtccagcagccgagcgttgcccaactgagatcaacaatggtagacccagcgatcaacttgtttttcctaaaaatgaaaggtgaactggaacagactaaagacaaactggaacaagcccaaaatgaactgagtgcctggaagtttacgcctgatagccaaacagggaaaaagttaatggcgaagtgtcgaatgcttatccaggagaatcaagagcttggaaggcagctgtcccagggacgtattgcacaacttgaagcagagttggctttacagaagaaatacagtgaggagcttaaaagcagtcaggatgaactgaatgacttcatcatccagcttgatgaagaagtagagggtatgcagagtaccattctagttctgcagcagcagctgaaggagacacgccagcagttggctcagtaccagcagcagcagtctcaggcctctgccccaagtaccagcaggactacagcttctgaacctgtagaacagtcagaggccacaagtaaagactgcagtcgtctgacaaacggaccaagtaatggtagctcctcccgccagaggacgtctgggtctggatttcacagggagggcaacacaaccgaagatgactttccttcttctccagggaatggtaataagtcctccaacagctcagaggagagaactggcagaggaggtagtggttacgtaaatcaactcagtgcggggtatgaaagtgtagactctcccacgggcagtgaaaactctctcacacaccaatcaaatgacacagactccagtcatgaccctcaagaggagaaagcagtgagtgggaaaggtaatcgaactgtgggttcccgccacgttcagaatggcttggactcaagtgtaaatgtacagggttcagttttgtaa
Sequence Length
1191
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,801 Da
NCBI Official Full Name
Homo sapiens Wilms tumor 1 associated protein, mRNA
NCBI Official Synonym Full Names
Wilms tumor 1 associated protein
NCBI Official Symbol
WTAP
NCBI Official Synonym Symbols
Mum2
NCBI Protein Information
pre-mRNA-splicing regulator WTAP
UniProt Protein Name
Pre-mRNA-splicing regulator WTAP
UniProt Gene Name
WTAP
UniProt Synonym Gene Names
KIAA0105; hFL(2)D
UniProt Entry Name
FL2D_HUMAN

NCBI Description

The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

WTAP: Regulates G2/M cell-cycle transition by binding to the 3' UTR of CCNA2, which enhances its stability. Impairs WT1 DNA- binding ability and inhibits expression of WT1 target genes. May be involved in mRNA splicing regulation. Belongs to the fl(2)d family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Spliceosome; Nucleolus

Chromosomal Location of Human Ortholog: 6q25-q27

Cellular Component: nuclear membrane; nuclear speck; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: gene expression; regulation of alternative nuclear mRNA splicing, via spliceosome

Research Articles on WTAP

Similar Products

Product Notes

The WTAP wtap (Catalog #AAA1265896) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccaacg aagaacctct tcccaagaag gttcgattga gtgaaacaga cttcaaagtt atggcaagag atgagttaat tctaagatgg aaacaatatg aagcatatgt acaagctttg gagggcaagt acacagatct taactctaat gatgtaactg gcctaagaga gtctgaagaa aaactaaagc aacaacagca ggagtctgca cgcagggaaa acatccttgt aatgcgacta gcaaccaagg aacaagagat gcaagagtgt actactcaaa tccagtacct caagcaagtc cagcagccga gcgttgccca actgagatca acaatggtag acccagcgat caacttgttt ttcctaaaaa tgaaaggtga actggaacag actaaagaca aactggaaca agcccaaaat gaactgagtg cctggaagtt tacgcctgat agccaaacag ggaaaaagtt aatggcgaag tgtcgaatgc ttatccagga gaatcaagag cttggaaggc agctgtccca gggacgtatt gcacaacttg aagcagagtt ggctttacag aagaaataca gtgaggagct taaaagcagt caggatgaac tgaatgactt catcatccag cttgatgaag aagtagaggg tatgcagagt accattctag ttctgcagca gcagctgaag gagacacgcc agcagttggc tcagtaccag cagcagcagt ctcaggcctc tgccccaagt accagcagga ctacagcttc tgaacctgta gaacagtcag aggccacaag taaagactgc agtcgtctga caaacggacc aagtaatggt agctcctccc gccagaggac gtctgggtct ggatttcaca gggagggcaa cacaaccgaa gatgactttc cttcttctcc agggaatggt aataagtcct ccaacagctc agaggagaga actggcagag gaggtagtgg ttacgtaaat caactcagtg cggggtatga aagtgtagac tctcccacgg gcagtgaaaa ctctctcaca caccaatcaa atgacacaga ctccagtcat gaccctcaag aggagaaagc agtgagtggg aaaggtaatc gaactgtggg ttcccgccac gttcagaatg gcttggactc aagtgtaaat gtacagggtt cagttttgta a. It is sometimes possible for the material contained within the vial of "WTAP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.