Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NME4 cdna clone

NME4 cDNA Clone

Gene Names
NME4; NDPK-D; NM23H4; nm23-H4
Synonyms
NME4; NME4 cDNA Clone; NME4 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcggcctcttctggcgctccgcgctgcgggggctgcgctgcggcccgcgggccccgggcccgagcctgctagtgcgccacggctcgggagggccctcctggacccgggagcggaccctggtggcggtgaagcccgatggcgtgcaacggcggctcgttggggacgtgatccagcgctttgagaggcggggcttcacgctggtggggatgaagatgctgcaggcaccagagagcgtccttgccgagcactaccaggacctgcggaggaagcccttctaccctgccctcatccgctacatgagctctgggcctgtggtggccatggtctgggaagggtacaatgtcgtccgcgcctcaagggccatgattggacacaccgactcggctgaggctgccccaggaaccataaggggtgacttcagcgtccacatcagcaggaatgtcatccacgccagcgactccgtggagggggcccagcgggagatccagctgtggttccagagcagtgagctggtgagctgggcagatgggggccagcacagcagcatccacccagcctga
Sequence Length
564
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,979 Da
NCBI Official Full Name
Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
NCBI Official Synonym Full Names
NME/NM23 nucleoside diphosphate kinase 4
NCBI Official Symbol
NME4
NCBI Official Synonym Symbols
NDPK-D; NM23H4; nm23-H4
NCBI Protein Information
nucleoside diphosphate kinase, mitochondrial
UniProt Protein Name
Nucleoside diphosphate kinase, mitochondrial
UniProt Gene Name
NME4
UniProt Synonym Gene Names
NM23D; NDK; NDP kinase, mitochondrial; NDPKD
UniProt Entry Name
NDKM_HUMAN

NCBI Description

The nucleoside diphosphate (NDP) kinases (EC 2.7.4.6) are ubiquitous enzymes that catalyze transfer of gamma-phosphates, via a phosphohistidine intermediate, between nucleoside and dioxynucleoside tri- and diphosphates. The enzymes are products of the nm23 gene family, which includes NME4 (Milon et al., 1997 [PubMed 9099850]).[supplied by OMIM, May 2008]

Uniprot Description

NME4: Major role in the synthesis of nucleoside triphosphates other than ATP. Belongs to the NDK family.

Protein type: Kinase, nucleoside diphosphate; Nucleotide Metabolism - purine; Kinase, other; Nucleotide Metabolism - pyrimidine; EC 2.7.4.6; Mitochondrial; Other group; NDK family

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: mitochondrial inner membrane; mitochondrion

Molecular Function: nucleoside diphosphate kinase activity; protein binding

Biological Process: nucleobase, nucleoside and nucleotide interconversion; nucleoside metabolic process; nucleoside triphosphate biosynthetic process; purine nucleotide metabolic process; pyrimidine nucleotide metabolic process; regulation of apoptosis

Research Articles on NME4

Similar Products

Product Notes

The NME4 nme4 (Catalog #AAA1265808) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcggcc tcttctggcg ctccgcgctg cgggggctgc gctgcggccc gcgggccccg ggcccgagcc tgctagtgcg ccacggctcg ggagggccct cctggacccg ggagcggacc ctggtggcgg tgaagcccga tggcgtgcaa cggcggctcg ttggggacgt gatccagcgc tttgagaggc ggggcttcac gctggtgggg atgaagatgc tgcaggcacc agagagcgtc cttgccgagc actaccagga cctgcggagg aagcccttct accctgccct catccgctac atgagctctg ggcctgtggt ggccatggtc tgggaagggt acaatgtcgt ccgcgcctca agggccatga ttggacacac cgactcggct gaggctgccc caggaaccat aaggggtgac ttcagcgtcc acatcagcag gaatgtcatc cacgccagcg actccgtgga gggggcccag cgggagatcc agctgtggtt ccagagcagt gagctggtga gctgggcaga tgggggccag cacagcagca tccacccagc ctga. It is sometimes possible for the material contained within the vial of "NME4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.