Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC38A1 cdna clone

SLC38A1 cDNA Clone

Gene Names
SLC38A1; ATA1; NAT2; SAT1; SNAT1
Synonyms
SLC38A1; SLC38A1 cDNA Clone; SLC38A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatgcatttcaaaagtggactcgaattaactgagttgcaaaacatgacagtgcccgaggatgataacattagcaatgactccaatgatttcaccgaagtagaaaatggtcagataaatagcaagtttatttctgatcgtgaaagtagaagaagtctcacaaacagccatttggaaaaaaagaagtgtgatgagtatattccaggtacaacctccttaggcatgtctgtttttaacctaagcaacgccattatgggcagtgggattttgggactcgcctttgccctggcaaacactggaatcctactttttctggtacttttgacttcagtgacattgctgtctatatattcaataaacctcctattgatctgttcaaaagaaacaggctgcatggtgtatgaaaagctgggggaacaagtctttggcaccacagggaagttcgtaatctttggagccacctctctacagaacactggagcaatgctgagctacctcttcatcgtaaaaaatgaactaccctctgccataaagtttctaatgggaaaggaagagacattttcagcctggtacgtggatggccgcgttctggtggtgatagttacctttggcataattctccctctgtgtctcttgaagaacttagggtatcttggctatactagtggattttccttgagctgtatggtttttttcctaattgtggttatttacaagaaatttcaaattccctgcattgttccagagctaaattcaacaataagtgctaattcaacaaatgctgacacgtgtacgccaaaatatgttaccttcaattcaaagaccgtgtatgctttacccaccattgcatttgcatttgtttgccacccgtcagtcctgccaatttacagtgagcttaaagaccgatcacagaaaaaaatgcagatggtttcaaacatctcctttttcgccatgtttgttatgtacttcttgactgccatttttggctacttgacattctatgacaacgtgcagtccgacctccttcacaaatatcagagtaaagatgacattctcatcctgacagtgcggctggctgtcattgttgctgtgatcctcacagtgccggtgttatttttcacggttcgttcatctttatttgaactggctaagaaaacaaagtttaatttatgtcgtcataccgtggttacctgcatactcttggttgttatcaacttgttggtgatcttcataccctccatgaaggatatttttggagtcgtaggagttacatctgctaacatgcttattttcattcttccttcatctctttatttaaaaatcacagaccaggatggagataaaggaactcaaagaatttgggctgcccttttcttgggcctgggggtgttgttctccttggtcagcattcccttggtcatctatgactgggcctgctcatcgagtagtgacgaaggccactga
Sequence Length
1464
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,048 Da
NCBI Official Full Name
Homo sapiens solute carrier family 38, member 1, mRNA
NCBI Official Synonym Full Names
solute carrier family 38 member 1
NCBI Official Symbol
SLC38A1
NCBI Official Synonym Symbols
ATA1; NAT2; SAT1; SNAT1
NCBI Protein Information
sodium-coupled neutral amino acid transporter 1
UniProt Protein Name
Sodium-coupled neutral amino acid transporter 1
UniProt Gene Name
SLC38A1
UniProt Synonym Gene Names
ATA1; NAT2; SAT1; SNAT1
UniProt Entry Name
S38A1_HUMAN

NCBI Description

Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008]

Uniprot Description

SLC38A1: Functions as a sodium-dependent amino acid transporter. Mediates the saturable, pH-sensitive and electrogenic cotransport of glutamine and sodium ions with a stoichiometry of 1:1. May also transport small zwitterionic and aliphatic amino acids with a lower affinity. May supply glutamatergic and GABAergic neurons with glutamine which is required for the synthesis of the neurotransmitters glutamate and GABA. Belongs to the amino acid/polyamine transporter 2 family.

Protein type: Transporter, SLC family; Membrane protein, multi-pass; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 12q13.11

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: amino acid transmembrane transporter activity; L-amino acid transmembrane transporter activity; L-asparagine transmembrane transporter activity; L-glutamine transmembrane transporter activity; L-histidine transmembrane transporter activity; protein binding

Biological Process: amino acid transport; asparagine transport; glutamine transport; histidine transport; neurotransmitter uptake

Research Articles on SLC38A1

Similar Products

Product Notes

The SLC38A1 slc38a1 (Catalog #AAA1265641) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcatt tcaaaagtgg actcgaatta actgagttgc aaaacatgac agtgcccgag gatgataaca ttagcaatga ctccaatgat ttcaccgaag tagaaaatgg tcagataaat agcaagttta tttctgatcg tgaaagtaga agaagtctca caaacagcca tttggaaaaa aagaagtgtg atgagtatat tccaggtaca acctccttag gcatgtctgt ttttaaccta agcaacgcca ttatgggcag tgggattttg ggactcgcct ttgccctggc aaacactgga atcctacttt ttctggtact tttgacttca gtgacattgc tgtctatata ttcaataaac ctcctattga tctgttcaaa agaaacaggc tgcatggtgt atgaaaagct gggggaacaa gtctttggca ccacagggaa gttcgtaatc tttggagcca cctctctaca gaacactgga gcaatgctga gctacctctt catcgtaaaa aatgaactac cctctgccat aaagtttcta atgggaaagg aagagacatt ttcagcctgg tacgtggatg gccgcgttct ggtggtgata gttacctttg gcataattct ccctctgtgt ctcttgaaga acttagggta tcttggctat actagtggat tttccttgag ctgtatggtt tttttcctaa ttgtggttat ttacaagaaa tttcaaattc cctgcattgt tccagagcta aattcaacaa taagtgctaa ttcaacaaat gctgacacgt gtacgccaaa atatgttacc ttcaattcaa agaccgtgta tgctttaccc accattgcat ttgcatttgt ttgccacccg tcagtcctgc caatttacag tgagcttaaa gaccgatcac agaaaaaaat gcagatggtt tcaaacatct cctttttcgc catgtttgtt atgtacttct tgactgccat ttttggctac ttgacattct atgacaacgt gcagtccgac ctccttcaca aatatcagag taaagatgac attctcatcc tgacagtgcg gctggctgtc attgttgctg tgatcctcac agtgccggtg ttatttttca cggttcgttc atctttattt gaactggcta agaaaacaaa gtttaattta tgtcgtcata ccgtggttac ctgcatactc ttggttgtta tcaacttgtt ggtgatcttc ataccctcca tgaaggatat ttttggagtc gtaggagtta catctgctaa catgcttatt ttcattcttc cttcatctct ttatttaaaa atcacagacc aggatggaga taaaggaact caaagaattt gggctgccct tttcttgggc ctgggggtgt tgttctcctt ggtcagcatt cccttggtca tctatgactg ggcctgctca tcgagtagtg acgaaggcca ctga. It is sometimes possible for the material contained within the vial of "SLC38A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.