Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNHIT1 cdna clone

ZNHIT1 cDNA Clone

Gene Names
ZNHIT1; CG1I; ZNFN4A1
Synonyms
ZNHIT1; ZNHIT1 cDNA Clone; ZNHIT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggagaagaaaacttcggttcgctcccaggaccccgggcagcggcgggtgctggaccgggctgcccggcagcgtcgcatcaaccggcagctggaggccctggagaatgacaacttccaggatgacccccacgcgggactccctcagctcggcaagagactgcctcagtttgatgacgatgcggacactggaaagaaaaagaagaaaacccgaggtgatcattttaaacttcgcttccgaaaaaactttcaggccctgttggaggagcagaacttgagtgtggccgagggccctaactacctgacggcctgtgcgggacccccatcgcggccccagcgccccttctgtgctgtctgtggcttcccatccccctacacctgtgtcagctgcggtgcccggtactgcactgtgcgctgtctggggacccaccaggagaccaggtgtctgaagtggactgtgtga
Sequence Length
465
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,536 Da
NCBI Official Full Name
Homo sapiens zinc finger, HIT type 1, mRNA
NCBI Official Synonym Full Names
zinc finger HIT-type containing 1
NCBI Official Symbol
ZNHIT1
NCBI Official Synonym Symbols
CG1I; ZNFN4A1
NCBI Protein Information
zinc finger HIT domain-containing protein 1
UniProt Protein Name
Zinc finger HIT domain-containing protein 1
UniProt Gene Name
ZNHIT1
UniProt Synonym Gene Names
CGBP1; ZNFN4A1
UniProt Entry Name
ZNHI1_HUMAN

Uniprot Description

ZNHIT1: Seems to play a role in p53-mediated apoptosis induction. Belongs to the ZNHIT1 family.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: nucleus

Molecular Function: histone deacetylase binding; nucleosome binding; protein binding

Biological Process: histone exchange; regulation of histone deacetylation

Research Articles on ZNHIT1

Similar Products

Product Notes

The ZNHIT1 znhit1 (Catalog #AAA1270579) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggaga agaaaacttc ggttcgctcc caggaccccg ggcagcggcg ggtgctggac cgggctgccc ggcagcgtcg catcaaccgg cagctggagg ccctggagaa tgacaacttc caggatgacc cccacgcggg actccctcag ctcggcaaga gactgcctca gtttgatgac gatgcggaca ctggaaagaa aaagaagaaa acccgaggtg atcattttaa acttcgcttc cgaaaaaact ttcaggccct gttggaggag cagaacttga gtgtggccga gggccctaac tacctgacgg cctgtgcggg acccccatcg cggccccagc gccccttctg tgctgtctgt ggcttcccat ccccctacac ctgtgtcagc tgcggtgccc ggtactgcac tgtgcgctgt ctggggaccc accaggagac caggtgtctg aagtggactg tgtga. It is sometimes possible for the material contained within the vial of "ZNHIT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.