ZNF830 cdna clone
ZNF830 cDNA Clone
Gene Names
ZNF830; OMCG1; CCDC16
Synonyms
ZNF830; ZNF830 cDNA Clone; ZNF830 cdna clone
Sequence
atgaaggagaagcagcgtctgagcaccagtcggaaacggatagaatctccattcgcgaagtacaaccgtttggggcagctgagttgtgccctgtgtaacactccggttaagagcgagctcctgtggcagactcacgtcctgggaaagcagcaccgagagaaagtggccgagctgaaaggcgcgaaggaagccagccagggttcgtccgccagttcagcgcctcagtccgtcaagaggaaagcgccggacgcagacgaccaagatgtcaagagagcgaaggccaccttggtgcctcaggtacagccctccacatctgcgtggaccaccaactttgacaaaataggaaaggagttcattagagcgactcccagtaagccttcaggactcactttactccccgattatgaagatgaggaggaggaggaagaggaggaggaaggagatggagaaagaaaaaggggggacgccagcaagccgctctccgacgcacagggcaaggagcactcagtttcctcttcacgggaggtaacaagtagtgtgctgccaaacgatttctttagtactaatcctcccaaggcccccataattcctcattcagggtcaattgagaaagcagaaatacatgaaaaagtggtggaaaggagagaaaacaccgcggaagcgttaccggaaggtttttttgacgaccctgaggtagatgcaagagtacgaaaggttgatgctccaaaagatcagatggacaaagagtgggacgaattccaaaaagccatgaggcaggtcaacactatttccgaagccatagttgccgaagaggatgaggagggacggttggaccgccagattggggagatcgatgagcagatagagtgttaccgacgggtggaaaagctacggaatcgccaggatgaaataaaaaataaacttaaagaaatcctgaccataaaagaactgcagaaaaaggaagaagagaatgctgacagcgatgatgagggggaactacaggatttgttgtctcaggattggagggtgaaaggggcattgttatag
Sequence Length
1047
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
41,999 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 830, mRNA
NCBI Official Synonym Full Names
zinc finger protein 830
NCBI Official Symbol
ZNF830
NCBI Official Synonym Symbols
OMCG1; CCDC16
NCBI Protein Information
zinc finger protein 830
UniProt Protein Name
Zinc finger protein 830
Protein Family
UniProt Gene Name
ZNF830
UniProt Entry Name
ZN830_HUMAN
Uniprot Description
ZNF830: May act as a regulator of the cell cycle in embryos by participating in control of M phase.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 17q12
Cellular Component: cytoplasm; nucleoplasm; nucleus
Molecular Function: protein binding
Biological Process: mitosis; mitotic cell cycle DNA replication checkpoint; negative regulation of apoptosis; ovarian follicle development; preantral ovarian follicle growth; replication fork protection; transcription-coupled nucleotide-excision repair
Research Articles on ZNF830
Similar Products
Product Notes
The ZNF830 znf830 (Catalog #AAA1273772) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggaga agcagcgtct gagcaccagt cggaaacgga tagaatctcc attcgcgaag tacaaccgtt tggggcagct gagttgtgcc ctgtgtaaca ctccggttaa gagcgagctc ctgtggcaga ctcacgtcct gggaaagcag caccgagaga aagtggccga gctgaaaggc gcgaaggaag ccagccaggg ttcgtccgcc agttcagcgc ctcagtccgt caagaggaaa gcgccggacg cagacgacca agatgtcaag agagcgaagg ccaccttggt gcctcaggta cagccctcca catctgcgtg gaccaccaac tttgacaaaa taggaaagga gttcattaga gcgactccca gtaagccttc aggactcact ttactccccg attatgaaga tgaggaggag gaggaagagg aggaggaagg agatggagaa agaaaaaggg gggacgccag caagccgctc tccgacgcac agggcaagga gcactcagtt tcctcttcac gggaggtaac aagtagtgtg ctgccaaacg atttctttag tactaatcct cccaaggccc ccataattcc tcattcaggg tcaattgaga aagcagaaat acatgaaaaa gtggtggaaa ggagagaaaa caccgcggaa gcgttaccgg aaggtttttt tgacgaccct gaggtagatg caagagtacg aaaggttgat gctccaaaag atcagatgga caaagagtgg gacgaattcc aaaaagccat gaggcaggtc aacactattt ccgaagccat agttgccgaa gaggatgagg agggacggtt ggaccgccag attggggaga tcgatgagca gatagagtgt taccgacggg tggaaaagct acggaatcgc caggatgaaa taaaaaataa acttaaagaa atcctgacca taaaagaact gcagaaaaag gaagaagaga atgctgacag cgatgatgag ggggaactac aggatttgtt gtctcaggat tggagggtga aaggggcatt gttatag. It is sometimes possible for the material contained within the vial of "ZNF830, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
