ZNF645 cdna clone
ZNF645 cDNA Clone
Gene Names
ZNF645; CT138; HAKAIL
Synonyms
ZNF645; ZNF645 cDNA Clone; ZNF645 cdna clone
Sequence
atgaacaagatgcctgctggtgaacaagaatgtgaatataacaaagaagggaagtactactctaaaggagttaaactggtgagaaaaaagaaaaaaattcctggttaccgttggggggacattaagataaacatcataggtgaaaaggatgatttaccaattcatttctgtgacaaatgtgatttgcctattaaaatctatgggcgaataattccgtgcaagcatgctttttgctatcactgtgctaatttatatgacaaagtcggatataaagtatgtccgcgctgtcgttatcctgtgctgagaattgaggcgcataaacgaggttctgtcttcatgtgtagtattgttcagcagtgcaagagaacatacttgtctcagaaaagcttacaggctcatatcaaacgccgccataagagagctcgaaaacaagttaccagcgcttcgcttgaaaaagttcgtcctcatattgctccgccacaaactgaaatctctgaaatccctaaaagactgcaagacagggaccatctaagctatattccaccagaacagcacaccatggtgtcactaccgtctgtgcaacatatgctacaagagcaacataatcagccacataaggatattcaggctcctcccccagaactatctctaagtctgccttttcccatccagtgggaaaccgttagtatttttacgagaaaacatggcaatttaacagttgatcatattcagaataactcagattctggtgctaagaagccaacacctcccgactattatcctgagtgtcaaagtcaaccagcggtatcgtcccctcatcatattatacctcagaaacagcattatgcgccacctccatctccatcatcaccagtaaaccatcaaatgccatatcctcctcaggatgtagttactcctaactcggttcgtagccaagtgccagctctaaccacgacctacgatccatcatctggatatattattgtaaaggtgccacctgatatgaattctcctccactacgtgctccccagtctcaaaatggtaatccatctgcaagtgaatttgcttctcaccattataaccttaacattttacctcagttcaccgaaaatcaagaaaccttgagccctcagtttacacaaacagatgcaatggatcatagaaggtggcctgcatggaaacgactgtcaccttgtccaccaacgcggagtccacctccttcaaccctacatggtcgatcacatcattcacaccagagaagacatagacggtattaa
Sequence Length
1278
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,785 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 645, mRNA
NCBI Official Synonym Full Names
zinc finger protein 645
NCBI Official Symbol
ZNF645
NCBI Official Synonym Symbols
CT138; HAKAIL
NCBI Protein Information
E3 ubiquitin-protein ligase ZNF645
UniProt Protein Name
E3 ubiquitin-protein ligase ZNF645
Protein Family
UniProt Gene Name
ZNF645
UniProt Entry Name
ZN645_HUMAN
NCBI Description
This gene encodes a member of the zinc finger domain-containing protein family. This family member contains both a RING-type and a C2H2-type of zinc finger domain, and it may function as an E3 ubiquitin-protein ligase. Protein localization suggests a role in human sperm production and quality control. [provided by RefSeq, Aug 2011]
Uniprot Description
ZNF645: E3 ubiquitin ligase catalyzing the covalent attachment of ubiquitin moieties onto substrate proteins.
Protein type: Cancer Testis Antigen (CTA); Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.19; C2H2-type zinc finger protein; EC 6.3.2.-
Chromosomal Location of Human Ortholog: Xp22.11
Biological Process: regulation of cell adhesion
Research Articles on ZNF645
Similar Products
Product Notes
The ZNF645 znf645 (Catalog #AAA1274491) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaaga tgcctgctgg tgaacaagaa tgtgaatata acaaagaagg gaagtactac tctaaaggag ttaaactggt gagaaaaaag aaaaaaattc ctggttaccg ttggggggac attaagataa acatcatagg tgaaaaggat gatttaccaa ttcatttctg tgacaaatgt gatttgccta ttaaaatcta tgggcgaata attccgtgca agcatgcttt ttgctatcac tgtgctaatt tatatgacaa agtcggatat aaagtatgtc cgcgctgtcg ttatcctgtg ctgagaattg aggcgcataa acgaggttct gtcttcatgt gtagtattgt tcagcagtgc aagagaacat acttgtctca gaaaagctta caggctcata tcaaacgccg ccataagaga gctcgaaaac aagttaccag cgcttcgctt gaaaaagttc gtcctcatat tgctccgcca caaactgaaa tctctgaaat ccctaaaaga ctgcaagaca gggaccatct aagctatatt ccaccagaac agcacaccat ggtgtcacta ccgtctgtgc aacatatgct acaagagcaa cataatcagc cacataagga tattcaggct cctcccccag aactatctct aagtctgcct tttcccatcc agtgggaaac cgttagtatt tttacgagaa aacatggcaa tttaacagtt gatcatattc agaataactc agattctggt gctaagaagc caacacctcc cgactattat cctgagtgtc aaagtcaacc agcggtatcg tcccctcatc atattatacc tcagaaacag cattatgcgc cacctccatc tccatcatca ccagtaaacc atcaaatgcc atatcctcct caggatgtag ttactcctaa ctcggttcgt agccaagtgc cagctctaac cacgacctac gatccatcat ctggatatat tattgtaaag gtgccacctg atatgaattc tcctccacta cgtgctcccc agtctcaaaa tggtaatcca tctgcaagtg aatttgcttc tcaccattat aaccttaaca ttttacctca gttcaccgaa aatcaagaaa ccttgagccc tcagtttaca caaacagatg caatggatca tagaaggtgg cctgcatgga aacgactgtc accttgtcca ccaacgcgga gtccacctcc ttcaacccta catggtcgat cacatcattc acaccagaga agacatagac ggtattaa. It is sometimes possible for the material contained within the vial of "ZNF645, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
