ZNF567 cdna clone
ZNF567 cDNA Clone
Synonyms
ZNF567; ZNF567 cDNA Clone; ZNF567 cdna clone
Sequence
atggatgtgatgttggaaaactattgccacctcatctctgtggggtgtcacatgaccaaacctgatgtgatcctcaagttggaacgaggagaagagccatggacatcatttgcaggtcatacctgcttggaagaaaactggaaagctgaagactttttagtgaaattcaaggaacaccaagagaagtattctagatcagttgtaagcatcaaccacaaaaaactggtgaaggagaagagtaaaatatatgaaaagacatttactctaggcaaaaaccctgtgaattcaaaaaatctacctcctgaatatgatactcatggaaggattttgaaaaatgtttcagaattaatcatcagtaatctaaatcctgcaagaaagagacttagtgagtataatggatatgggaaatcactcctgagtactaaacaagagactactcatcctgaagtcaaatcccataatcaaagtgccagagctttcagtcataatgaagttcttatgcagtatcagaaaacggaaactccagcacagtcatttggatataatgactgtgagaaatcattccttcaaaggggaggcctgattacacatagtagaccttacaaaggagaaaacccatctgtatataataaaaaaagaagagcaaccaatattgaaaaaaaacatacatgcaatgaatgtgggaaatctttctgcaggaaatcagtattgattctgcatcagggaattcactcagaagaaaaaccctatcaatgtcatcaatgtggaaatgcatttagaaggaaatcatatctcattgatcatcagagaactcacacaggagagaaaccctttgtttgcaatgaatgtggtaagtccttccgcctcaagacagccctcactgatcatcagagaacacacacaggggagaaatcgtatgaatgtctgcaatgtaggaatgccttcagattgaagtcacacctcattcgtcatcagagaactcacacgggagagaaaccatatgagtgtaatgactgtgggaagtccttccgccagaagacaacactctctctacatcagagaatccatacaggtgagaaaccctatatttgtaaagaatgtgggaagtcctttcaccagaaggcaaatcttactgtacatcagagaactcatacaggggaaaagccctatatttgtaatgaatgtgggaaatccttctcccagaagacaacccttgctcttcatgagaaaactcataatgaggagaaaccctatatttgtagtgaatgtggaaagtccttccgccagaagacaacccttgtagcacatcagagaacacatacaggggagaaatcttatgaatgtcctcactgtgggaaggcctttagaatgaagtcatacctcattgatcatcaccgaactcacacaggagagaaaccatatgaatgtaatgaatgtggtaaatcattcagtcaaaagacaaatctcaatctacatcagagaattcatacaggggagaaaccctatgtttgtaatgaatgtgggaagtcctttcgccagaaagcaaccctcactgtacatcagaaaatacataccggccagaaatcctatgaatgtcctcagtgtgggaaagcctttagcaggaagtcatatctcattcatcatcaaagaactcatacgggagagaaaccatataaatgtagtgaatgtggaaagtgcttccgccagaagacaaatcttattgtacatcagagaactcacacaggtgagaaaccctatgtttgtaatgagtgtggtaagtctttcagttataagagaaacctcattgtccatcaaagaactcacaagggagaaaacattgaaatgcaataa
Sequence Length
1851
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,612 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 567, mRNA
NCBI Official Synonym Full Names
zinc finger protein 567
NCBI Official Symbol
ZNF567
NCBI Protein Information
zinc finger protein 567
UniProt Protein Name
Zinc finger protein 567
Protein Family
UniProt Gene Name
ZNF567
UniProt Entry Name
ZN567_HUMAN
Uniprot Description
ZNF567: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 19q13.12
Molecular Function: protein binding; transcription factor activity
Biological Process: negative regulation of transcription from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter
Similar Products
Product Notes
The ZNF567 znf567 (Catalog #AAA1275610) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgtga tgttggaaaa ctattgccac ctcatctctg tggggtgtca catgaccaaa cctgatgtga tcctcaagtt ggaacgagga gaagagccat ggacatcatt tgcaggtcat acctgcttgg aagaaaactg gaaagctgaa gactttttag tgaaattcaa ggaacaccaa gagaagtatt ctagatcagt tgtaagcatc aaccacaaaa aactggtgaa ggagaagagt aaaatatatg aaaagacatt tactctaggc aaaaaccctg tgaattcaaa aaatctacct cctgaatatg atactcatgg aaggattttg aaaaatgttt cagaattaat catcagtaat ctaaatcctg caagaaagag acttagtgag tataatggat atgggaaatc actcctgagt actaaacaag agactactca tcctgaagtc aaatcccata atcaaagtgc cagagctttc agtcataatg aagttcttat gcagtatcag aaaacggaaa ctccagcaca gtcatttgga tataatgact gtgagaaatc attccttcaa aggggaggcc tgattacaca tagtagacct tacaaaggag aaaacccatc tgtatataat aaaaaaagaa gagcaaccaa tattgaaaaa aaacatacat gcaatgaatg tgggaaatct ttctgcagga aatcagtatt gattctgcat cagggaattc actcagaaga aaaaccctat caatgtcatc aatgtggaaa tgcatttaga aggaaatcat atctcattga tcatcagaga actcacacag gagagaaacc ctttgtttgc aatgaatgtg gtaagtcctt ccgcctcaag acagccctca ctgatcatca gagaacacac acaggggaga aatcgtatga atgtctgcaa tgtaggaatg ccttcagatt gaagtcacac ctcattcgtc atcagagaac tcacacggga gagaaaccat atgagtgtaa tgactgtggg aagtccttcc gccagaagac aacactctct ctacatcaga gaatccatac aggtgagaaa ccctatattt gtaaagaatg tgggaagtcc tttcaccaga aggcaaatct tactgtacat cagagaactc atacagggga aaagccctat atttgtaatg aatgtgggaa atccttctcc cagaagacaa cccttgctct tcatgagaaa actcataatg aggagaaacc ctatatttgt agtgaatgtg gaaagtcctt ccgccagaag acaacccttg tagcacatca gagaacacat acaggggaga aatcttatga atgtcctcac tgtgggaagg cctttagaat gaagtcatac ctcattgatc atcaccgaac tcacacagga gagaaaccat atgaatgtaa tgaatgtggt aaatcattca gtcaaaagac aaatctcaat ctacatcaga gaattcatac aggggagaaa ccctatgttt gtaatgaatg tgggaagtcc tttcgccaga aagcaaccct cactgtacat cagaaaatac ataccggcca gaaatcctat gaatgtcctc agtgtgggaa agcctttagc aggaagtcat atctcattca tcatcaaaga actcatacgg gagagaaacc atataaatgt agtgaatgtg gaaagtgctt ccgccagaag acaaatctta ttgtacatca gagaactcac acaggtgaga aaccctatgt ttgtaatgag tgtggtaagt ctttcagtta taagagaaac ctcattgtcc atcaaagaac tcacaaggga gaaaacattg aaatgcaata a. It is sometimes possible for the material contained within the vial of "ZNF567, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
