Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF26 cdna clone

ZNF26 cDNA Clone

Gene Names
ZNF26; KOX20; HEL-179
Synonyms
ZNF26; ZNF26 cDNA Clone; ZNF26 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaccagtttccggacagcttcgtgctggggattattgtcattcaaggatatatctatggagttcacctgggatgaatggcagctactggattctacacagaagtacctgtacagagatgtgatattggaaaactatcataacctgatatcagtggggtatcatggtaccaagcctgacttaatcttcaagttggaacaaggagaagatccatggataataaatgccaaaatttccaggcagagctgtccagatggctgggaagaatggtaccagaacaatcaagatgagcttgagagtattgaaagaagctatgcttgtagtgtgttgggaagacttaatctgagcaaaacccatgattcttcaagacagagactctataacacacgtggaaaaagtttgacacaaaactcagctccaagcagaagttatttaagaaagaatcctgataagtttcatggttatgaagaaccatattttcttaagcatcaaagagctcatagcatagaaaaaaactgtgtgtgtagtgaatgtgggaaagcttttcgttgtaagtcacagctcattgtacatctcagaattcatacaggagagagaccttatgaatgcagtaaatgtgaaagagccttcagtgccaagtcaaaccttaatgctcatcagagagttcatacaggagaaaaaccctactcatgtagtgagtgcgagaaggtcttctctttcaggtcacagctcattgtccatcaggaaattcacacaggagggaaaccctatggctgcagtgaatgtgggaaagcctacagttggaaatcacagcttcttttacaccagagaagtcacacaggagtgaaaccgtatgaatgcagcgaatgtgggaaagcctttagtttgaagtctccattcgttgtacaccagagaactcatacaggagtgaaaccccataaatgcagtgaatgtgggaaagcctttaggagtaagtcctatctccttgttcacatccgaatgcatacaggagaaaaaccctatcaatgcagtgattgtgggaaagccttcaatatgaagacacaactcattgtacatcagggagttcacacaggaaataatccttatcaatgcggcgaatgtgggaaagcctttggtaggaaggaacagctcactgcacatctgagagctcatgcaggagagaagccctatggatgcagtgaatgtgggaaggctttcagcagcaagtcataccttgttatacataggagaacacacaccggagagagaccctatgaatgtagtttgtgtgagagagccttttgtggaaaatcacagctgattatacatcagagaactcattcaactgagaagccctatgaatgcaatgaatgtgaaaaagcctaccctaggaaggcatcacttcagatacaccagaaaactcattcgggagagaaaccttttaaatgcagtgaatgtggaaaagccttcactcagaagtcatctctcagtgaacatcagagagttcacactggagagaaaccatggaaatgctctgaatgtgggaaatccttctgttggaattcagggcttcgtatacatcggaagactcataaatga
Sequence Length
1602
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,282 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 26, mRNA
NCBI Official Synonym Full Names
zinc finger protein 26
NCBI Official Symbol
ZNF26
NCBI Official Synonym Symbols
KOX20; HEL-179
NCBI Protein Information
zinc finger protein 26
UniProt Protein Name
Zinc finger protein 26
UniProt Gene Name
ZNF26
UniProt Synonym Gene Names
KOX20
UniProt Entry Name
ZNF26_HUMAN

Uniprot Description

ZNF26: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 12q24.33

Molecular Function: protein binding; transcription factor activity

Biological Process: regulation of transcription, DNA-dependent

Similar Products

Product Notes

The ZNF26 znf26 (Catalog #AAA1277990) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccacca gtttccggac agcttcgtgc tggggattat tgtcattcaa ggatatatct atggagttca cctgggatga atggcagcta ctggattcta cacagaagta cctgtacaga gatgtgatat tggaaaacta tcataacctg atatcagtgg ggtatcatgg taccaagcct gacttaatct tcaagttgga acaaggagaa gatccatgga taataaatgc caaaatttcc aggcagagct gtccagatgg ctgggaagaa tggtaccaga acaatcaaga tgagcttgag agtattgaaa gaagctatgc ttgtagtgtg ttgggaagac ttaatctgag caaaacccat gattcttcaa gacagagact ctataacaca cgtggaaaaa gtttgacaca aaactcagct ccaagcagaa gttatttaag aaagaatcct gataagtttc atggttatga agaaccatat tttcttaagc atcaaagagc tcatagcata gaaaaaaact gtgtgtgtag tgaatgtggg aaagcttttc gttgtaagtc acagctcatt gtacatctca gaattcatac aggagagaga ccttatgaat gcagtaaatg tgaaagagcc ttcagtgcca agtcaaacct taatgctcat cagagagttc atacaggaga aaaaccctac tcatgtagtg agtgcgagaa ggtcttctct ttcaggtcac agctcattgt ccatcaggaa attcacacag gagggaaacc ctatggctgc agtgaatgtg ggaaagccta cagttggaaa tcacagcttc ttttacacca gagaagtcac acaggagtga aaccgtatga atgcagcgaa tgtgggaaag cctttagttt gaagtctcca ttcgttgtac accagagaac tcatacagga gtgaaacccc ataaatgcag tgaatgtggg aaagccttta ggagtaagtc ctatctcctt gttcacatcc gaatgcatac aggagaaaaa ccctatcaat gcagtgattg tgggaaagcc ttcaatatga agacacaact cattgtacat cagggagttc acacaggaaa taatccttat caatgcggcg aatgtgggaa agcctttggt aggaaggaac agctcactgc acatctgaga gctcatgcag gagagaagcc ctatggatgc agtgaatgtg ggaaggcttt cagcagcaag tcataccttg ttatacatag gagaacacac accggagaga gaccctatga atgtagtttg tgtgagagag ccttttgtgg aaaatcacag ctgattatac atcagagaac tcattcaact gagaagccct atgaatgcaa tgaatgtgaa aaagcctacc ctaggaaggc atcacttcag atacaccaga aaactcattc gggagagaaa ccttttaaat gcagtgaatg tggaaaagcc ttcactcaga agtcatctct cagtgaacat cagagagttc acactggaga gaaaccatgg aaatgctctg aatgtgggaa atccttctgt tggaattcag ggcttcgtat acatcggaag actcataaat ga. It is sometimes possible for the material contained within the vial of "ZNF26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.