ZNF207 cdna clone

ZNF207 cDNA Clone

Gene Names

ZNF207; BuGZ; hBuGZ

Synonyms

ZNF207; ZNF207 cDNA Clone; ZNF207 cdna clone

Ordering
Cat. Num. AAA1270980 For Research Use Only!

Sequence

atgggtcgcaagaagaagaagcagctgaagccgtggtgctggtattgtaatagagattttgatgatgagaagatccttattcagcaccaaaaagcaaagcattttaaatgccatatatgtcacaagaaattgtatacaggacctggcttagctattcattgcatgcaggtacataaagaaacaatagatgccgtaccaaatgcaatacctggaagaacagacatagagttggaaatatatggtatggaaggtattccagaaaaagacatggatgaaagacgacgacttcttgaacagaaaacacaagaaagtcaaaaaaagaagcaacaagatgattctgatgaatatgatgatgacgactctgcagcctcaacttcatttcagccacagcctgttcaacctcagcaaggttatattcctccaatggcacagccaggactgccaccagtaccaggagcaccaggaatgcctccaggcatacctccattaatgccaggtgttcctcctctgatgccaggaatgccaccagttatgccaggcatgccacctggattgcatcatcagagaaaatacacccagtcattttgcggtgaaaacataatgatgccaatgggtggaatgatgccacctggaccaggaataccacctctgatgcctggaatgccaccaggtatgcccccacctgttccacgtcctggaattcctccaatgactcaagcacaggctgtttcagcgccaggtattcttaatagaccacctgcaccaacagcaactgtacctgccccacagcctccagttactaagcctcttttccccagtgctggacaggctcaggcagctgtccaaggacctgttggtacagatttcaaacccttaaatagtacccctgcaacaactacagaacccccaaagcctacattccctgcttatacacagtctacagcttcaacaactagtacaacaaatagtactgcagctaaaccagcggcttcaataacaagtaagcctgctacacttacaacaactagtgcaaccagtaagttgatccatccagatgaggatatatccctggaagagagaagggcacagttacctaagtatcaacgtaatcttcctcggccaggacaggcccccatcggtaatccaccagttggaccaattggaggtatgatgccaccacagccaggcatcccacagcaacaaggaatgagacccccaatgccacctcatggtcagtatggtggtcatcatcaaggcatgccaggataccttcctggtgctatgcccccgtatgggcagggaccgccaatggtgcccccttaccagggtgggcctcctcgacctccgatgggaatgagacctcctgtaatgtcgcaaggtggccgttactga

Sequence Length

1392

Vector

pENTR223.1

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

33876613

NCBI GeneID

7756

Molecular Weight

52,694 Da

NCBI Official Full Name

Homo sapiens zinc finger protein 207, mRNA

NCBI Official Synonym Full Names

zinc finger protein 207

NCBI Official Symbol

ZNF207

NCBI Official Synonym Symbols

BuGZ; hBuGZ

NCBI Protein Information

BUB3-interacting and GLEBS motif-containing protein ZNF207

UniProt Protein Name

BUB3-interacting and GLEBS motif-containing protein ZNF207

Protein Family

BUB3-interacting and GLEBS motif-containing protein

UniProt Gene Name

ZNF207

UniProt Synonym Gene Names

hBuGZ

UniProt Entry Name

ZN207_HUMAN

Uniprot Description

ZNF207: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; C2H2-type zinc finger protein; Spliceosome

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: kinetochore; nucleolus; nucleus

Molecular Function: microtubule binding; protein binding

Biological Process: attachment of spindle microtubules to kinetochore; microtubule bundle formation; microtubule polymerization; mitotic cell cycle spindle assembly checkpoint; mitotic sister chromatid segregation; protein stabilization; regulation of chromosome segregation

Research Articles on ZNF207

1. BuGZ forms temperature-dependent liquid droplets alone or on microtubules in physiological buffers. Coacervation in vitro or in spindle and spindle matrix depends on hydrophobic residues in BuGZ. BuGZ coacervation and its binding to microtubules and tubulin are required to promote assembly of spindle and spindle matrix in Xenopus egg extract and in mammalian cells.

Similar Products

Product Notes

The ZNF207 znf207 (Catalog #AAA1270980) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcgca agaagaagaa gcagctgaag ccgtggtgct ggtattgtaa tagagatttt gatgatgaga agatccttat tcagcaccaa aaagcaaagc attttaaatg ccatatatgt cacaagaaat tgtatacagg acctggctta gctattcatt gcatgcaggt acataaagaa acaatagatg ccgtaccaaa tgcaatacct ggaagaacag acatagagtt ggaaatatat ggtatggaag gtattccaga aaaagacatg gatgaaagac gacgacttct tgaacagaaa acacaagaaa gtcaaaaaaa gaagcaacaa gatgattctg atgaatatga tgatgacgac tctgcagcct caacttcatt tcagccacag cctgttcaac ctcagcaagg ttatattcct ccaatggcac agccaggact gccaccagta ccaggagcac caggaatgcc tccaggcata cctccattaa tgccaggtgt tcctcctctg atgccaggaa tgccaccagt tatgccaggc atgccacctg gattgcatca tcagagaaaa tacacccagt cattttgcgg tgaaaacata atgatgccaa tgggtggaat gatgccacct ggaccaggaa taccacctct gatgcctgga atgccaccag gtatgccccc acctgttcca cgtcctggaa ttcctccaat gactcaagca caggctgttt cagcgccagg tattcttaat agaccacctg caccaacagc aactgtacct gccccacagc ctccagttac taagcctctt ttccccagtg ctggacaggc tcaggcagct gtccaaggac ctgttggtac agatttcaaa cccttaaata gtacccctgc aacaactaca gaacccccaa agcctacatt ccctgcttat acacagtcta cagcttcaac aactagtaca acaaatagta ctgcagctaa accagcggct tcaataacaa gtaagcctgc tacacttaca acaactagtg caaccagtaa gttgatccat ccagatgagg atatatccct ggaagagaga agggcacagt tacctaagta tcaacgtaat cttcctcggc caggacaggc ccccatcggt aatccaccag ttggaccaat tggaggtatg atgccaccac agccaggcat cccacagcaa caaggaatga gacccccaat gccacctcat ggtcagtatg gtggtcatca tcaaggcatg ccaggatacc ttcctggtgc tatgcccccg tatgggcagg gaccgccaat ggtgccccct taccagggtg ggcctcctcg acctccgatg ggaatgagac ctcctgtaat gtcgcaaggt ggccgttact ga. It is sometimes possible for the material contained within the vial of "ZNF207, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ZNF207 cdna clone