Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF167 cdna clone

ZNF167 cDNA Clone

Gene Names
ZKSCAN7; ZFP; ZNF64; ZNF167; ZNF448; ZSCAN39
Synonyms
ZNF167; ZNF167 cDNA Clone; ZNF167 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccactgcaggcaggggaaatttaggcctcatccccaggagcactgctttccagaagcaagaggggcgcctgactgtgaagcaggagccagcaaaccagacctgggggcagggcagcagtctccagaagaactatcctcctgtctgcgaaatcttccggctacacttcaggcaattgtgttaccacgagatgtctgggccgcaggaagcattgagccggcttcgggagctctgccgctggtggctcatgccagaggtgcacaccaaggagcagatcctggagctgctggtgcttgagcagttcctgagcatcctccctggggagctccggacctgggtgcagctgcatcaccctgagagtggtgaggaggctgtggctgtggtggaggatttccagagacacctcagtggatcagaggaggtttcagccccagcacagaaacaggaaatgcattttgaggagacaacagctctgggtacaacaaaggaatctcctcctacctcacccctcagtgggggctcagcccctggagcccacctggagcctccttatgacccagggacacaccacctccccagtggggacttcgctcaatgtacttctccagttcctacccttcctcaagtggggaactcaggagaccaagcaggggcaactgtacttcggatggtcaggccccaggatactgtggcatatgaggacctatctgtagactacactcagaagaaatggaaaagtctcacactcagtcagagagccctgcagtggaacatgatgccagaaaatcaccatagcatggcctccttgggctggagtacaatggcgtga
Sequence Length
831
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,787 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 167, mRNA
NCBI Official Synonym Full Names
zinc finger with KRAB and SCAN domains 7
NCBI Official Symbol
ZKSCAN7
NCBI Official Synonym Symbols
ZFP; ZNF64; ZNF167; ZNF448; ZSCAN39
NCBI Protein Information
zinc finger protein with KRAB and SCAN domains 7
UniProt Protein Name
Zinc finger protein with KRAB and SCAN domains 7
UniProt Gene Name
ZKSCAN7
UniProt Synonym Gene Names
ZNF167; ZNF448; ZNF64
UniProt Entry Name
ZKSC7_HUMAN

Uniprot Description

ZNF167: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; DNA-binding

Chromosomal Location of Human Ortholog: 3p21.32

Molecular Function: protein binding

Similar Products

Product Notes

The ZNF167 zkscan7 (Catalog #AAA1275161) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccactg caggcagggg aaatttaggc ctcatcccca ggagcactgc tttccagaag caagaggggc gcctgactgt gaagcaggag ccagcaaacc agacctgggg gcagggcagc agtctccaga agaactatcc tcctgtctgc gaaatcttcc ggctacactt caggcaattg tgttaccacg agatgtctgg gccgcaggaa gcattgagcc ggcttcggga gctctgccgc tggtggctca tgccagaggt gcacaccaag gagcagatcc tggagctgct ggtgcttgag cagttcctga gcatcctccc tggggagctc cggacctggg tgcagctgca tcaccctgag agtggtgagg aggctgtggc tgtggtggag gatttccaga gacacctcag tggatcagag gaggtttcag ccccagcaca gaaacaggaa atgcattttg aggagacaac agctctgggt acaacaaagg aatctcctcc tacctcaccc ctcagtgggg gctcagcccc tggagcccac ctggagcctc cttatgaccc agggacacac cacctcccca gtggggactt cgctcaatgt acttctccag ttcctaccct tcctcaagtg gggaactcag gagaccaagc aggggcaact gtacttcgga tggtcaggcc ccaggatact gtggcatatg aggacctatc tgtagactac actcagaaga aatggaaaag tctcacactc agtcagagag ccctgcagtg gaacatgatg ccagaaaatc accatagcat ggcctccttg ggctggagta caatggcgtg a. It is sometimes possible for the material contained within the vial of "ZNF167, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.