ZNF16 cdna clone
ZNF16 cDNA Clone
Gene Names
ZNF16; HZF1; KOX9
Synonyms
ZNF16; ZNF16 cDNA Clone; ZNF16 cdna clone
Sequence
atggagctctcagttccaggaccatccccctggacccctgcagcccaggcccgtgtgagagatgctcctgctgtgacccaccctggatctgcagcctgtggtaccccctgctgtagtgatactgagctggaagccatctgccctcactatcagcagccagattgtgacaccaggactgaagacaaggagtttcttcacaaggaagacattcatgaagatttggaatcacaggcagaaatatcagaaaactatgctggtgatgtttcccaggtacccgagcttggagatctgtgtgatgatgtatcagaaagagactggggagtccccgaaggcaggaggctgccacagtccctctcccaggagggggacttcacaccagctgccatggggctccttaggggccccttaggggagaaagatctggactgtaatggttttgacagtcgcttcagtctgagcccaaacctgatggcatgtcaggaaatccctacagaagagaggccacatccatatgacatgggtggccagagtttccagcacagtgtggacctaactggtcatgagggggttcccacagctgaaagtccactcatatgtaatgagtgtgggaaaaccttccaaggaaatcctgaccttattcagcgtcaaatagtccacactggggaggcttcctttatgtgtgatgattgtgggaaaaccttcagccagaactcagttcttaaaaaccgtcatcgatctcatatgagtgagaaagcttaccagtgcagcgaatgtgggaaagccttccgagggcactcagacttttctaggcatcagagtcaccacagcagtgagaggccttatatgtgtaatgaatgtggaaaagccttcagccagaactcgagccttaaaaagcaccaaaagtctcacatgagtgagaagccctatgaatgcaatgaatgtgggaaggcttttaggcggagctcaaacctcatccaacatcaaagaatccattctggggagaaaccgtatgtgtgcagtgagtgtgggaaggccttcaggcgaagctcaaacctcatcaaacaccacaggactcacacaggagagaagccttttgagtgtggcgagtgtgggaaagccttcagccagagtgcacacctgaggaagcaccagagggtccacactggagagaagccttatgagtgtaatgattgtggcaagcccttcagtcgggtctccaacctcattaagcaccacagggttcacactggagagaagccctataagtgcagtgactgtgggaaagcatttagtcagagctccagccttattcagcatcggagaattcacactggagaaaagcctcacgtgtgtaatgtatgtggaaaagcctttagttatagctcagtgctccgaaagcaccagatcatccacacgggagagaagccgtacagatgcagtgtctgtgggaaggccttcagccacagctcagccctcattcagcaccagggcgtgcacacaggcgacaagccctacgcctgccacgagtgtgggaagacctttggtcgcagctccaacctcatccttcaccagcgagtccacactggagagaagccctatgaatgtactgaatgtggaaaaaccttcagccagagctcaaccctcattcagcatcagaggattcataatgggctgaagccccatgaatgtaaccagtgtggtaaagccttcaaccgaagctcaaatctcattcaccaccagaaagttcatactggggaaaaaccctacacctgtgttgaatgtggtaagggcttcagccagagctcacacctcattcagcatcagataatccacacgggcgagcgcccctacaaatgcagtgagtgtgggaaagccttcagtcagcgttcggtcctcatccagcaccagaggattcacactggggtgaagccctatgactgtgctgcttgtgggaaagccttcagccagcgatcaaagttgatcaaacaccagttgattcacaccagggaatag
Sequence Length
2013
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
76,472 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 16, mRNA
NCBI Official Synonym Full Names
zinc finger protein 16
NCBI Official Symbol
ZNF16
NCBI Official Synonym Symbols
HZF1; KOX9
NCBI Protein Information
zinc finger protein 16
UniProt Protein Name
Zinc finger protein 16
Protein Family
UniProt Gene Name
ZNF16
UniProt Synonym Gene Names
HZF1; KOX9
UniProt Entry Name
ZNF16_HUMAN
NCBI Description
The protein encoded by this gene contains multiple tandem zinc finger motifs. The encoded protein is involved in the differentiation of erythroid and megakaryocytic cells. This gene is located in a cluster of related genes on chromosome 8 encoding zinc finger proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Uniprot Description
ZNF16: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 8q24
Cellular Component: nucleus
Molecular Function: protein binding; transcription factor activity
Biological Process: negative regulation of apoptosis; positive regulation of cell proliferation; positive regulation of erythrocyte differentiation; positive regulation of kinase activity; positive regulation of megakaryocyte differentiation; regulation of transcription, DNA-dependent
Research Articles on ZNF16
Similar Products
Product Notes
The ZNF16 znf16 (Catalog #AAA1275054) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctct cagttccagg accatccccc tggacccctg cagcccaggc ccgtgtgaga gatgctcctg ctgtgaccca ccctggatct gcagcctgtg gtaccccctg ctgtagtgat actgagctgg aagccatctg ccctcactat cagcagccag attgtgacac caggactgaa gacaaggagt ttcttcacaa ggaagacatt catgaagatt tggaatcaca ggcagaaata tcagaaaact atgctggtga tgtttcccag gtacccgagc ttggagatct gtgtgatgat gtatcagaaa gagactgggg agtccccgaa ggcaggaggc tgccacagtc cctctcccag gagggggact tcacaccagc tgccatgggg ctccttaggg gccccttagg ggagaaagat ctggactgta atggttttga cagtcgcttc agtctgagcc caaacctgat ggcatgtcag gaaatcccta cagaagagag gccacatcca tatgacatgg gtggccagag tttccagcac agtgtggacc taactggtca tgagggggtt cccacagctg aaagtccact catatgtaat gagtgtggga aaaccttcca aggaaatcct gaccttattc agcgtcaaat agtccacact ggggaggctt cctttatgtg tgatgattgt gggaaaacct tcagccagaa ctcagttctt aaaaaccgtc atcgatctca tatgagtgag aaagcttacc agtgcagcga atgtgggaaa gccttccgag ggcactcaga cttttctagg catcagagtc accacagcag tgagaggcct tatatgtgta atgaatgtgg aaaagccttc agccagaact cgagccttaa aaagcaccaa aagtctcaca tgagtgagaa gccctatgaa tgcaatgaat gtgggaaggc ttttaggcgg agctcaaacc tcatccaaca tcaaagaatc cattctgggg agaaaccgta tgtgtgcagt gagtgtggga aggccttcag gcgaagctca aacctcatca aacaccacag gactcacaca ggagagaagc cttttgagtg tggcgagtgt gggaaagcct tcagccagag tgcacacctg aggaagcacc agagggtcca cactggagag aagccttatg agtgtaatga ttgtggcaag cccttcagtc gggtctccaa cctcattaag caccacaggg ttcacactgg agagaagccc tataagtgca gtgactgtgg gaaagcattt agtcagagct ccagccttat tcagcatcgg agaattcaca ctggagaaaa gcctcacgtg tgtaatgtat gtggaaaagc ctttagttat agctcagtgc tccgaaagca ccagatcatc cacacgggag agaagccgta cagatgcagt gtctgtggga aggccttcag ccacagctca gccctcattc agcaccaggg cgtgcacaca ggcgacaagc cctacgcctg ccacgagtgt gggaagacct ttggtcgcag ctccaacctc atccttcacc agcgagtcca cactggagag aagccctatg aatgtactga atgtggaaaa accttcagcc agagctcaac cctcattcag catcagagga ttcataatgg gctgaagccc catgaatgta accagtgtgg taaagccttc aaccgaagct caaatctcat tcaccaccag aaagttcata ctggggaaaa accctacacc tgtgttgaat gtggtaaggg cttcagccag agctcacacc tcattcagca tcagataatc cacacgggcg agcgccccta caaatgcagt gagtgtggga aagccttcag tcagcgttcg gtcctcatcc agcaccagag gattcacact ggggtgaagc cctatgactg tgctgcttgt gggaaagcct tcagccagcg atcaaagttg atcaaacacc agttgattca caccagggaa tag. It is sometimes possible for the material contained within the vial of "ZNF16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
