Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZMAT1 cdna clone

ZMAT1 cDNA Clone

Synonyms
ZMAT1; ZMAT1 cDNA Clone; ZMAT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtcttgctctgtcaccaggctggagtgcagtggcgcaatctcggctcactgcagcctccacctcccgggttcaagcgactcccctgcctcagcctcccaaatagctgggactacagacgccatttggaatgaacaggaaaaggctgaactttttacagataagttttgtcaagtatgtggagtgatgctacagtttgaatcacaaagaatttcacattatgagggtgaaaaacatgctcaaaatgttagtttttattttcaaatgcatggggaacaaaatgaagtgcctggtaagaaaatgaagatgcatgttgagaattttcaggtgcataggtatgaaggagtggacaaaaacaaattttgtgatctctgcaacatgatgtttagctctccacttattgctcagtctcactatgtgggaaaggtccatgctaaaaaactgaagcaattaatggaggaacatgatcaggcatctccatcaggatttcaaccagagatggcatttagtatgagaacctatgtttgccatatttgtagtattgcttttacatctttagatatgttccggtcccacatgcaaggaagtgaacatcaaattaaagaatccattgttatcaatctagtgaagaattcaaggaagacacaagactcttaccaaaatgagtgtgcagattacatcaatgtgcagaaagccagaggactagaggccaagacttgtttcagaaagatggaagagagttctttggaaacccgtagatacagagaagtggtcgattccagacccagacatagaatgtttgaacaaagactcccatttgagactttccggacatacgcagcaccatacaatatttcacaagcaatggaaaagcagttacctcattcaaagaagacatatgactctttccaagatgaacttgaagattacatcaaagtacagaaagccacaggactagatccaaagacttgtttcagaaagatgagagagaactctgtggatactcatgggtacagagaaatggttgattctggacccagatcaagaatgtgtgagcaaagattttcacatgaggcttcccagacctaccaacgaccataccatatttcaccagtggaaagccagttacctcagtggctaccaacccattcaaagaggacatatgattctttccaagatgaacttgaagattacataaaagtgcagaaagccagaggactagagccaaaaacttgtttcagaaagataggagatagctctgtagaaacacacaggaacagagaaatggttgatgtcagacccagacatagaatgttggagcaaaagctcccatgtgagactttccagacctattcaggaccatatagtatttcacaagtagtggaaaaccagttacctcattgcttaccagctcatgatagcaaacagagactagattctattagctactgtcaactcaccagagactgtttcccagaaaaaccagtacccttgagccttaatcagcaagaaaataactctggctcatacagtgtagaatctgaagtttacaagcacctctcttcagaaaacaatactgctgaccatcaagcaggtcataaacggaaacatcagaagagaaaacgacacctagaagaaggcaaagaaaggccagagaaagagcagtcaagcataaaaggaaaaagagttatgaagatacagatttag
Sequence Length
1710
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,545 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:5311633, containing frame-shift errors
NCBI Official Synonym Full Names
zinc finger matrin-type 1
NCBI Official Symbol
ZMAT1
NCBI Protein Information
zinc finger matrin-type protein 1
UniProt Protein Name
Zinc finger matrin-type protein 1
UniProt Gene Name
ZMAT1
UniProt Synonym Gene Names
KIAA1789
UniProt Entry Name
ZMAT1_HUMAN

NCBI Description

This gene encodes a protein containing Cys2-His2 (C2H2)-type zinc fingers, which are similar to those found in the nuclear matrix protein matrin 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

ZMAT1: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: Xq21

Molecular Function: p53 binding; RNA binding

Research Articles on ZMAT1

Similar Products

Product Notes

The ZMAT1 zmat1 (Catalog #AAA1265661) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtctt gctctgtcac caggctggag tgcagtggcg caatctcggc tcactgcagc ctccacctcc cgggttcaag cgactcccct gcctcagcct cccaaatagc tgggactaca gacgccattt ggaatgaaca ggaaaaggct gaacttttta cagataagtt ttgtcaagta tgtggagtga tgctacagtt tgaatcacaa agaatttcac attatgaggg tgaaaaacat gctcaaaatg ttagttttta ttttcaaatg catggggaac aaaatgaagt gcctggtaag aaaatgaaga tgcatgttga gaattttcag gtgcataggt atgaaggagt ggacaaaaac aaattttgtg atctctgcaa catgatgttt agctctccac ttattgctca gtctcactat gtgggaaagg tccatgctaa aaaactgaag caattaatgg aggaacatga tcaggcatct ccatcaggat ttcaaccaga gatggcattt agtatgagaa cctatgtttg ccatatttgt agtattgctt ttacatcttt agatatgttc cggtcccaca tgcaaggaag tgaacatcaa attaaagaat ccattgttat caatctagtg aagaattcaa ggaagacaca agactcttac caaaatgagt gtgcagatta catcaatgtg cagaaagcca gaggactaga ggccaagact tgtttcagaa agatggaaga gagttctttg gaaacccgta gatacagaga agtggtcgat tccagaccca gacatagaat gtttgaacaa agactcccat ttgagacttt ccggacatac gcagcaccat acaatatttc acaagcaatg gaaaagcagt tacctcattc aaagaagaca tatgactctt tccaagatga acttgaagat tacatcaaag tacagaaagc cacaggacta gatccaaaga cttgtttcag aaagatgaga gagaactctg tggatactca tgggtacaga gaaatggttg attctggacc cagatcaaga atgtgtgagc aaagattttc acatgaggct tcccagacct accaacgacc ataccatatt tcaccagtgg aaagccagtt acctcagtgg ctaccaaccc attcaaagag gacatatgat tctttccaag atgaacttga agattacata aaagtgcaga aagccagagg actagagcca aaaacttgtt tcagaaagat aggagatagc tctgtagaaa cacacaggaa cagagaaatg gttgatgtca gacccagaca tagaatgttg gagcaaaagc tcccatgtga gactttccag acctattcag gaccatatag tatttcacaa gtagtggaaa accagttacc tcattgctta ccagctcatg atagcaaaca gagactagat tctattagct actgtcaact caccagagac tgtttcccag aaaaaccagt acccttgagc cttaatcagc aagaaaataa ctctggctca tacagtgtag aatctgaagt ttacaagcac ctctcttcag aaaacaatac tgctgaccat caagcaggtc ataaacggaa acatcagaag agaaaacgac acctagaaga aggcaaagaa aggccagaga aagagcagtc aagcataaaa ggaaaaagag ttatgaagat acagatttag. It is sometimes possible for the material contained within the vial of "ZMAT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.