Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZKSCAN4 cdna clone

ZKSCAN4 cDNA Clone

Gene Names
ZKSCAN4; ZNF307; ZNF427; ZSCAN36; P1P373C6
Synonyms
ZKSCAN4; ZKSCAN4 cDNA Clone; ZKSCAN4 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagagaaccgagaaaaaacgcagccctggacgcccagtctgcagaagaccagacggggctcctgaccgtgaaggtggagaaggaggaagcctccgccttgacggcggaggtgagagcaccctgcagccctgctcggggccccgaacgctcccgccagcgcttccgaggcttccgctacccggaggctgcgggcccccgcgaggcgttgagccggctccgagaactctgcggacaatggctgcagcctgagatgcacagcaaggagcagatcctggagctgctggtgctggagcagttcctgaccatcctgccggggaatctgcagagctgggtgcgggagcagcatccagagagcggggaggaggtggtggtgctattggagtatttggagaggcagctggatgagccggcgccgcaggttcccgttggtgaccaggggcaagaactgctctgttgcaagatggcactattgacacaaactcaagggtctcaaagtagccagtgccagccaatgaaggctctgttcaagcatgaatctctgggatcccagcccttacacgatagagttctccaggttcctgggcttgcccagggagggtgctgcagagaagatgcaatggtagcttccaggctcactccagggtcccagggtttgctgaaaatggaagatgtggccctgaccctcactcctgggtggacacagctggattcatctcaggtgaacctctacagagatgaaaagcaggagaaccatagcagcctggtctcccttggtggtgaaatacagactaagagcagggacttgcctccagtcaagaagcttccagaaaaggagcatgggaagatatgccacctgagggaagacattgcccagattcctacacatgcagaagctggtgaacaggagggcaggttacaaagaaagcagaaaaatgccatagggagtaggcgacattattgccatgaatgtggaaagagttttgctcaaagttcaggcctgactaaacacaggagaatccacactggtgagaaaccctatgaatgtgaagactgtggaaagaccttcattgggagctctgcccttgtcattcatcagagagtccacactggtgagaagccatatgagtgtgaagaatgtggtaaggtcttcagtcacagctcaaaccttatcaaacaccagagaacccacactggggagaagccctatgagtgtgatgactgtgggaagaccttcagccagagctgcagcctccttgaacatcacaaaattcatactggggagaagccataccagtgcaatatgtgtggcaaagcctttaggcggaattcacatctcctgagacatcagaggattcatggtgataaaaatgttcagaatcctgagcacggggagtcctgggaaagtcagggtaggacggaaagccagtgggaaaatactgaggctcccgtgtcttataaatgtaatgagtgtgagagaagtttcacacggaatagaagtcttattgaacatcagaaaatccacactggtgagaaaccctatcagtgtgacacatgtggaaaaggtttcactcgaacttcataccttgttcaacatcagagaagccatgtagggaaaaaaactctttcacagtga
Sequence Length
1638
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,579 Da
NCBI Official Full Name
Homo sapiens zinc finger with KRAB and SCAN domains 4, mRNA
NCBI Official Synonym Full Names
zinc finger with KRAB and SCAN domains 4
NCBI Official Symbol
ZKSCAN4
NCBI Official Synonym Symbols
ZNF307; ZNF427; ZSCAN36; P1P373C6
NCBI Protein Information
zinc finger protein with KRAB and SCAN domains 4
UniProt Protein Name
Zinc finger protein with KRAB and SCAN domains 4
UniProt Gene Name
ZKSCAN4
UniProt Synonym Gene Names
ZNF307; ZNF427
UniProt Entry Name
ZKSC4_HUMAN

Uniprot Description

ZKSCAN4: May be involved in the transcriptional activation of MDM2 and EP300 genes. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; DNA-binding

Chromosomal Location of Human Ortholog: 6p21

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: lysosome organization and biogenesis; negative regulation of autophagy

Research Articles on ZKSCAN4

Similar Products

Product Notes

The ZKSCAN4 zkscan4 (Catalog #AAA1274513) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagag aaccgagaaa aaacgcagcc ctggacgccc agtctgcaga agaccagacg gggctcctga ccgtgaaggt ggagaaggag gaagcctccg ccttgacggc ggaggtgaga gcaccctgca gccctgctcg gggccccgaa cgctcccgcc agcgcttccg aggcttccgc tacccggagg ctgcgggccc ccgcgaggcg ttgagccggc tccgagaact ctgcggacaa tggctgcagc ctgagatgca cagcaaggag cagatcctgg agctgctggt gctggagcag ttcctgacca tcctgccggg gaatctgcag agctgggtgc gggagcagca tccagagagc ggggaggagg tggtggtgct attggagtat ttggagaggc agctggatga gccggcgccg caggttcccg ttggtgacca ggggcaagaa ctgctctgtt gcaagatggc actattgaca caaactcaag ggtctcaaag tagccagtgc cagccaatga aggctctgtt caagcatgaa tctctgggat cccagccctt acacgataga gttctccagg ttcctgggct tgcccaggga gggtgctgca gagaagatgc aatggtagct tccaggctca ctccagggtc ccagggtttg ctgaaaatgg aagatgtggc cctgaccctc actcctgggt ggacacagct ggattcatct caggtgaacc tctacagaga tgaaaagcag gagaaccata gcagcctggt ctcccttggt ggtgaaatac agactaagag cagggacttg cctccagtca agaagcttcc agaaaaggag catgggaaga tatgccacct gagggaagac attgcccaga ttcctacaca tgcagaagct ggtgaacagg agggcaggtt acaaagaaag cagaaaaatg ccatagggag taggcgacat tattgccatg aatgtggaaa gagttttgct caaagttcag gcctgactaa acacaggaga atccacactg gtgagaaacc ctatgaatgt gaagactgtg gaaagacctt cattgggagc tctgcccttg tcattcatca gagagtccac actggtgaga agccatatga gtgtgaagaa tgtggtaagg tcttcagtca cagctcaaac cttatcaaac accagagaac ccacactggg gagaagccct atgagtgtga tgactgtggg aagaccttca gccagagctg cagcctcctt gaacatcaca aaattcatac tggggagaag ccataccagt gcaatatgtg tggcaaagcc tttaggcgga attcacatct cctgagacat cagaggattc atggtgataa aaatgttcag aatcctgagc acggggagtc ctgggaaagt cagggtagga cggaaagcca gtgggaaaat actgaggctc ccgtgtctta taaatgtaat gagtgtgaga gaagtttcac acggaataga agtcttattg aacatcagaa aatccacact ggtgagaaac cctatcagtg tgacacatgt ggaaaaggtt tcactcgaac ttcatacctt gttcaacatc agagaagcca tgtagggaaa aaaactcttt cacagtga. It is sometimes possible for the material contained within the vial of "ZKSCAN4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.