Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZHX1 cdna clone

ZHX1 cDNA Clone

Synonyms
ZHX1; ZHX1 cDNA Clone; ZHX1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaagcaggcgaaaatcaacaacaccttgcatggtccttgccagtgaacaagatccagaccttgagttgatatcagatttggatgaaggtcctcctgtgcttacacctgtagaaaacaccagagcagagagtatctcaagtgatgaagaggttcatgaatctgtggattcagacaatcagcaaaataaaaaagttgaaggtggatatgaatgtaaatattgtacttttcaaactccagatctaaatatgtttacttttcatgtggattcggaacatcccaatgtagtgctaaattcatcctatgtttgtgtcgaatgcaattttcttaccaaaaggtatgatgcactttctgagcataatctgaaatatcacccaggagaagagaattttaagttgactatggtgaaacgtaataaccagacaatctttgaacaaacaataaatgatctgacttttgatggtagttttgttaaagaggagaatgcagagcaagcagaatctacagaagtttcttcttcgggaatatctatcagtaaaactcctatcatgaaaatgatgaaaaataaagtggaaaataaacggattgcagttcatcataactcagttgaggacgttcctgaagagaaagagaatgaaatcaaaccagaccgtgaagaaattgtagaaaatccaagttcttcagcttctgaatctaatacaagtacttccattgtaaacagaatacatccaagtactgccagcacggtagtgacaccagcagcagttcttcctggattggcacagatgataactgctgtatctgctcagcagaattctaatttgattcccaaagtcttaatccctgttaatagcattcccacctacaatgctgcattggataacaatccccttttacttaacacctacaacaagttcccttacccaacaatgtcagaaattacagttctttctgctcaagcaaaatatacagaggaacagatcaagatatggttttcagcccaacgtttaaaacatggtgttagttggactcccgaggaagtagaggaggcaagaaggaaacaattcaatggaacagtgcatactgtacctcagaccataactgttattcctacacacatttccacagggagtaatggtttaccatctattttacagacatgccaaatagttggtcagcctggtctggtccttactcaagtggctggaacaaacaccttgccagttacagcacctatagccttgacagtggcaggcgttccaagtcaaaataatatacagaaaagtcaggtacctgctgctcagcctactgcagaaacaaagccagcaacagcagcagttccaacttctcaaagtgtcaaacatgaaactgcattggtaaaccctgattcatttggcattcgggcaaaaaagacaaaagagcaactggcagaattaaaagttagctaccttaaaaatcagtttccccatgattcagaaattatcagacttatgaaaataacaggcctgacgaaaggagagattaaaaaatggtttagtgacacaaggtacaaccagagaaattcaaagagtaatcagtgcttacatctcaacaatgattcctctaccaccattattatagactccagtgatgaaaccacggaatccccaactgttggtactgcacagcctaagcaatcctggaatccttttcctgactttactccccaaaagtttaaagagaaaactgcagagcagcttcgtgtccttcaggcaagttttctcaacagctctgtacttacagatgaagaattaaataggttaagggcacaaaccaaacttaccagaagagaaatcgatgcttggtttacagagaagaagaaatcaaaagctttaaaggaagagaaaatggaaatagatgaaagtaatgcaggtagttccaaagaagaagctggagaaacttctcctgcagatgaatctggtgcacctaagtcagggagtacaggcaagatatgtaaaaaaacacctgagcagctgcacatgcttaagagtgcatttgtccggacacagtggccatcaccagaagagtatgacaagttggccaaagaaagcgggcttgctagaacagacatagttagttggtttggggacacccgttatgcttggaagaatggaaacttgaaatggtactactactatcagagcgccaattcaagtagtatgaatggtctgtcttcccttaggaaaagagggagagggagacccaaaggacggggaagaggaagaccgcgtgggcggcctagaggaagcaaaagaattaacaactgggacaggggaccatcactcataaaatttaaaactggaactgcaatacttaaggattattacctgaagcgcaagtttcttaatgagcaagaccttgatgaacttgttaacaaatcacatatgggctatgagcaggtcagagagtggtttgcagaaagacagagaagatcagaattaggtatagaattatttgaggaaaatgaggaggaagatgaagttattgatgaccaggaagaggatgaagaagaaacagatgatagtgacacttgggaacctccacgacatgtgaaacggaagctgtctaaatcagatgactga
Sequence Length
2622
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,285 Da
NCBI Official Full Name
Homo sapiens zinc fingers and homeoboxes 1, mRNA
NCBI Official Synonym Full Names
zinc fingers and homeoboxes 1
NCBI Official Symbol
ZHX1
NCBI Protein Information
zinc fingers and homeoboxes protein 1
UniProt Protein Name
Zinc fingers and homeoboxes protein 1
UniProt Gene Name
ZHX1
UniProt Entry Name
ZHX1_HUMAN

NCBI Description

The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]

Uniprot Description

ZHX1: Acts as a transcriptional repressor. Increases DNMT3B- mediated repressive transcriptional activity when DNMT3B is tethered to DNA. May link molecule between DNMT3B and other co- repressor proteins. Belongs to the ZHX family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 8q24.13

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding; protein heterodimerization activity; transcription corepressor activity; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent

Research Articles on ZHX1

Similar Products

Product Notes

The ZHX1 zhx1 (Catalog #AAA1267168) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaagca ggcgaaaatc aacaacacct tgcatggtcc ttgccagtga acaagatcca gaccttgagt tgatatcaga tttggatgaa ggtcctcctg tgcttacacc tgtagaaaac accagagcag agagtatctc aagtgatgaa gaggttcatg aatctgtgga ttcagacaat cagcaaaata aaaaagttga aggtggatat gaatgtaaat attgtacttt tcaaactcca gatctaaata tgtttacttt tcatgtggat tcggaacatc ccaatgtagt gctaaattca tcctatgttt gtgtcgaatg caattttctt accaaaaggt atgatgcact ttctgagcat aatctgaaat atcacccagg agaagagaat tttaagttga ctatggtgaa acgtaataac cagacaatct ttgaacaaac aataaatgat ctgacttttg atggtagttt tgttaaagag gagaatgcag agcaagcaga atctacagaa gtttcttctt cgggaatatc tatcagtaaa actcctatca tgaaaatgat gaaaaataaa gtggaaaata aacggattgc agttcatcat aactcagttg aggacgttcc tgaagagaaa gagaatgaaa tcaaaccaga ccgtgaagaa attgtagaaa atccaagttc ttcagcttct gaatctaata caagtacttc cattgtaaac agaatacatc caagtactgc cagcacggta gtgacaccag cagcagttct tcctggattg gcacagatga taactgctgt atctgctcag cagaattcta atttgattcc caaagtctta atccctgtta atagcattcc cacctacaat gctgcattgg ataacaatcc ccttttactt aacacctaca acaagttccc ttacccaaca atgtcagaaa ttacagttct ttctgctcaa gcaaaatata cagaggaaca gatcaagata tggttttcag cccaacgttt aaaacatggt gttagttgga ctcccgagga agtagaggag gcaagaagga aacaattcaa tggaacagtg catactgtac ctcagaccat aactgttatt cctacacaca tttccacagg gagtaatggt ttaccatcta ttttacagac atgccaaata gttggtcagc ctggtctggt ccttactcaa gtggctggaa caaacacctt gccagttaca gcacctatag ccttgacagt ggcaggcgtt ccaagtcaaa ataatataca gaaaagtcag gtacctgctg ctcagcctac tgcagaaaca aagccagcaa cagcagcagt tccaacttct caaagtgtca aacatgaaac tgcattggta aaccctgatt catttggcat tcgggcaaaa aagacaaaag agcaactggc agaattaaaa gttagctacc ttaaaaatca gtttccccat gattcagaaa ttatcagact tatgaaaata acaggcctga cgaaaggaga gattaaaaaa tggtttagtg acacaaggta caaccagaga aattcaaaga gtaatcagtg cttacatctc aacaatgatt cctctaccac cattattata gactccagtg atgaaaccac ggaatcccca actgttggta ctgcacagcc taagcaatcc tggaatcctt ttcctgactt tactccccaa aagtttaaag agaaaactgc agagcagctt cgtgtccttc aggcaagttt tctcaacagc tctgtactta cagatgaaga attaaatagg ttaagggcac aaaccaaact taccagaaga gaaatcgatg cttggtttac agagaagaag aaatcaaaag ctttaaagga agagaaaatg gaaatagatg aaagtaatgc aggtagttcc aaagaagaag ctggagaaac ttctcctgca gatgaatctg gtgcacctaa gtcagggagt acaggcaaga tatgtaaaaa aacacctgag cagctgcaca tgcttaagag tgcatttgtc cggacacagt ggccatcacc agaagagtat gacaagttgg ccaaagaaag cgggcttgct agaacagaca tagttagttg gtttggggac acccgttatg cttggaagaa tggaaacttg aaatggtact actactatca gagcgccaat tcaagtagta tgaatggtct gtcttccctt aggaaaagag ggagagggag acccaaagga cggggaagag gaagaccgcg tgggcggcct agaggaagca aaagaattaa caactgggac aggggaccat cactcataaa atttaaaact ggaactgcaa tacttaagga ttattacctg aagcgcaagt ttcttaatga gcaagacctt gatgaacttg ttaacaaatc acatatgggc tatgagcagg tcagagagtg gtttgcagaa agacagagaa gatcagaatt aggtatagaa ttatttgagg aaaatgagga ggaagatgaa gttattgatg accaggaaga ggatgaagaa gaaacagatg atagtgacac ttgggaacct ccacgacatg tgaaacggaa gctgtctaaa tcagatgact ga. It is sometimes possible for the material contained within the vial of "ZHX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.