Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZFP36 cdna clone

ZFP36 cDNA Clone

Gene Names
ZFP36; TTP; G0S24; GOS24; TIS11; NUP475; zfp-36; RNF162A
Synonyms
ZFP36; ZFP36 cDNA Clone; ZFP36 cdna clone
Ordering
For Research Use Only!
Sequence
atggatctgactgccatctacgagagcctcctgtcgctgagccctgacgtgcccgtgccatccgaccatggagggactgagtccagcccaggctggggctcctcgggaccctggagcctgagcccctccgactccagcccgtctggggtcacctcccgcctgcctggccgctccaccagcctagtggagggccgcagctgtggctgggtgcccccaccccctggcttcgcaccgctggctccccgcctgggccctgagctgtcaccctcacccacttcgcccactgcaacctccaccaccccctcgcgctacaagactgagctatgtcggaccttctcagagagtgggcgctgccgctacggggccaagtgccagtttgcccatggcctgggcgagctgcgccaggccaatcgccaccccaaatacaagacggaactctgtcacaagttctacctccagggccgctgcccctacggctctcgctgccacttcatccacaaccctagcgaagacctggcggccccgggccaccctcctgtgcttcgccagagcatcagcttctccggcctgccctctggccgccggacctcaccaccaccaccaggcctggccggcccttccctgtcctccagctccttctcgccctccagctccccaccaccacctggggaccttccactgtcaccctctgccttctctgctgcccctggcacccccctggctcgaagagaccccaccccagtctgttgcccctcctgccgaagggccactcctatcagcgtctgggggcccttgggtggcctggttcggaccccctctgtacagtccctgggatccgaccctgatgaatatgccagcagcggcagcagcctggggggctctgactctcccgtcttcgaggcgggagtttttgcaccaccccagcccgtggcagccccccggcgactccccatcttcaatcgcatctctgtttctgagtga
Sequence Length
981
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,003 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 36, C3H type, homolog (mouse), mRNA
NCBI Official Synonym Full Names
ZFP36 ring finger protein
NCBI Official Symbol
ZFP36
NCBI Official Synonym Symbols
TTP; G0S24; GOS24; TIS11; NUP475; zfp-36; RNF162A
NCBI Protein Information
tristetraprolin
UniProt Protein Name
Tristetraprolin
UniProt Gene Name
ZFP36
UniProt Synonym Gene Names
G0S24; RNF162A; TIS11A; TTP; TTP; TIS11; Zfp-36
UniProt Entry Name
TTP_HUMAN

Uniprot Description

TTP: a CCCH zinc finger protein that has anti-inflammatory and arthritis suppressor activity. Regulates inflammatory responses at the post-transcriptional level. TTP deficiency in mice causes a severe inflammatory syndrome that includes autoimmunity, myeloid hyperplasia, and erosive arthritis. Binds to and destabilizes mRNA molecules with AU-rich elements (AREs). Has a high affinity for UUAUUUAUU mRNA sequences. Destabilizes tumor necrosis factor-alpha (TNF??), interleukin 2 (IL2), granulocyte-macrophage colony-stimulating factor (GM-CSF), transcription factor E47, and cyclooxygenase 2 (COX2) mRNAs. TNF?? and GM-CSF mRNAs are stabilized in TTP-deficient mice, causing a severe inflammatory syndrome. Conversely, high levels of TTP reduce inflammatory responses. TTP is a very low abundance protein that is rapidly induced by insulin, glucocorticoids, lipopolysaccharide (LPS), fetal calf serum, zinc, herpes simplex virus 1, green tea, and cinnamon. Once induced, the TTP protein is relatively stable. Has been experimentaly shown to be able to bind zinc. TTP is extensively phosphorylated.

Protein type: RNA-binding; DNA-binding

Chromosomal Location of Human Ortholog: 19q13.1

Cellular Component: cytoplasm; cytosol; nucleus; ribonucleoprotein complex; stress granule

Molecular Function: AU-rich element binding; C-C chemokine binding; enzyme binding; mRNA 3'-UTR binding; mRNA binding; protein binding; protein kinase binding; single-stranded RNA binding

Biological Process: MAPKKK cascade; miRNA-mediated gene silencing, negative regulation of translation; mRNA catabolic process; mRNA catabolic process, deadenylation-dependent decay; mRNA catabolic process, deadenylation-independent decay; mRNA transport; negative regulation of erythrocyte differentiation; negative regulation of transcription from RNA polymerase II promoter; poly(A) tail shortening; positive regulation of fat cell differentiation; regulation of keratinocyte differentiation; regulation of mRNA stability; regulation of tumor necrosis factor production; response to starvation; response to wounding

Research Articles on ZFP36

Similar Products

Product Notes

The ZFP36 zfp36 (Catalog #AAA1277147) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatctga ctgccatcta cgagagcctc ctgtcgctga gccctgacgt gcccgtgcca tccgaccatg gagggactga gtccagccca ggctggggct cctcgggacc ctggagcctg agcccctccg actccagccc gtctggggtc acctcccgcc tgcctggccg ctccaccagc ctagtggagg gccgcagctg tggctgggtg cccccacccc ctggcttcgc accgctggct ccccgcctgg gccctgagct gtcaccctca cccacttcgc ccactgcaac ctccaccacc ccctcgcgct acaagactga gctatgtcgg accttctcag agagtgggcg ctgccgctac ggggccaagt gccagtttgc ccatggcctg ggcgagctgc gccaggccaa tcgccacccc aaatacaaga cggaactctg tcacaagttc tacctccagg gccgctgccc ctacggctct cgctgccact tcatccacaa ccctagcgaa gacctggcgg ccccgggcca ccctcctgtg cttcgccaga gcatcagctt ctccggcctg ccctctggcc gccggacctc accaccacca ccaggcctgg ccggcccttc cctgtcctcc agctccttct cgccctccag ctccccacca ccacctgggg accttccact gtcaccctct gccttctctg ctgcccctgg cacccccctg gctcgaagag accccacccc agtctgttgc ccctcctgcc gaagggccac tcctatcagc gtctgggggc ccttgggtgg cctggttcgg accccctctg tacagtccct gggatccgac cctgatgaat atgccagcag cggcagcagc ctggggggct ctgactctcc cgtcttcgag gcgggagttt ttgcaccacc ccagcccgtg gcagcccccc ggcgactccc catcttcaat cgcatctctg tttctgagtg a. It is sometimes possible for the material contained within the vial of "ZFP36, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.