ZDHHC4 cdna clone
ZDHHC4 cDNA Clone
Gene Names
ZDHHC4; ZNF374
Synonyms
ZDHHC4; ZDHHC4 cDNA Clone; ZDHHC4 cdna clone
Sequence
atggactttctggtcctcttcttgttctacctggcttcggtgctgatgggtcttgttcttatctgcgtctgctcgaaaacccatagcttgaaaggcctggccaggggaggagcacagatattttcctgtataattccagaatgtcttcagagagccgtgcatggattgcttcattaccttttccatacgagaaaccacaccttcattgtcctgcacctggtcttgcaagggatggtttatactgagtacacctgggaagtatttggctactgtcaggagctggagttgtccttgcattaccttcttctgccctatctgctgctaggtgtaaacctgttttttttcaccctgacttgtggaaccaatcctggcattataacaaaagcaaatgaattattatttcttcatgtttatgaatttgatgaagtgatgtttccaaagaacgtgaggtgctctacttgtgatttaaggaaaccagctcgatccaagcactgcagtgtgtgtaactggtgtgtgcaccgtttcgaccatcactgtgtttgggtgaacaactgcatcggggcctggaacatcaggtacttcctcatctacgtcttgaccttgacggcctcggctgccaccgtcgccattgtgagcaccacttttctggtccacttggtggtgatgtcagatttataccaggagacttacatcgatgaccttggacacctccatgttatggacacggtctttcttattcagtacctgttcctgacttttccacggattgtcttcatgctgggctttgtcgtggttctgagcttcctcctgggtggctacctgttgtttgtcctgtatctggcggccaccaaccagactactaacgagtggtacagaggtgactgggcctggtgccagcgttgtccccttgtggcctggcctccgtcagcagagccccaagtccaccggaacattcactcccatgggcttcggagcaaccttcaagagatctttctacctgcctttccatgtcatgagaggaagaaacaagaatga
Sequence Length
1035
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,787 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 4, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 4
NCBI Official Symbol
ZDHHC4
NCBI Official Synonym Symbols
ZNF374
NCBI Protein Information
probable palmitoyltransferase ZDHHC4
UniProt Protein Name
Probable palmitoyltransferase ZDHHC4
Protein Family
UniProt Gene Name
ZDHHC4
UniProt Synonym Gene Names
ZNF374; DHHC-4
UniProt Entry Name
ZDHC4_HUMAN
Uniprot Description
ZDHHC4: Belongs to the DHHC palmitoyltransferase family.
Protein type: EC 2.3.1.225; Membrane protein, multi-pass; Membrane protein, integral; Transferase
Chromosomal Location of Human Ortholog: 7p22.1
Cellular Component: Golgi apparatus
Similar Products
Product Notes
The ZDHHC4 zdhhc4 (Catalog #AAA1272381) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactttc tggtcctctt cttgttctac ctggcttcgg tgctgatggg tcttgttctt atctgcgtct gctcgaaaac ccatagcttg aaaggcctgg ccaggggagg agcacagata ttttcctgta taattccaga atgtcttcag agagccgtgc atggattgct tcattacctt ttccatacga gaaaccacac cttcattgtc ctgcacctgg tcttgcaagg gatggtttat actgagtaca cctgggaagt atttggctac tgtcaggagc tggagttgtc cttgcattac cttcttctgc cctatctgct gctaggtgta aacctgtttt ttttcaccct gacttgtgga accaatcctg gcattataac aaaagcaaat gaattattat ttcttcatgt ttatgaattt gatgaagtga tgtttccaaa gaacgtgagg tgctctactt gtgatttaag gaaaccagct cgatccaagc actgcagtgt gtgtaactgg tgtgtgcacc gtttcgacca tcactgtgtt tgggtgaaca actgcatcgg ggcctggaac atcaggtact tcctcatcta cgtcttgacc ttgacggcct cggctgccac cgtcgccatt gtgagcacca cttttctggt ccacttggtg gtgatgtcag atttatacca ggagacttac atcgatgacc ttggacacct ccatgttatg gacacggtct ttcttattca gtacctgttc ctgacttttc cacggattgt cttcatgctg ggctttgtcg tggttctgag cttcctcctg ggtggctacc tgttgtttgt cctgtatctg gcggccacca accagactac taacgagtgg tacagaggtg actgggcctg gtgccagcgt tgtccccttg tggcctggcc tccgtcagca gagccccaag tccaccggaa cattcactcc catgggcttc ggagcaacct tcaagagatc tttctacctg cctttccatg tcatgagagg aagaaacaag aatga. It is sometimes possible for the material contained within the vial of "ZDHHC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
