ZDHHC24 cdna clone
ZDHHC24 cDNA Clone
Synonyms
ZDHHC24; ZDHHC24 cDNA Clone; ZDHHC24 cdna clone
Sequence
atggggcagccctgggcggctgggagcacggacggggcgcccgcgcagctgcctctcgtgctcaccgcgctgtgggccgcggccgtgggcctggagctggcttacgtgctggtgctcggtcccgggccgccgccgctgggacccctggcccgggccttgcagctggcgctggccgccttccagctgctcaacctgctgggcaacgtggggctcttcctgcgctcggatcccagcatccgtggcgtgatgctggccggccgcggtctgggccagggctgggcttactgctaccaatgccaaagccaggtgccgccacgcagcggacactgctctgcctgccgcgtctgcatcctgcgtcgggaccaccactgccgcctgctgggccgctgcgtgggcttcggcaactaccggcccttcctgtgcctgctgcttcatgccgccggcgtcctgctccacgtctctgtgctgctgggccctgcactgtcggccctgctgcgagcccacacgcccctccacatggctgccctcctcctgcttccctggctcatgttgctcacaggcagagtgtctctggcacagtttgccttggccttcgtgacggacacgtgcgtggcgggtgcgctgctgtgcggggctgggctgctcttccatgggatgctgctgctgcggggccagaccacatgggagtgggctcggggccagcactcctatgacctgggtccctgccacaacctgcaggcagccctggggccccgctgggccctcgtctggctctggcccttcctggcctccccattgcctggggatgggatcaccttccagaccacagcagatgtgggacacacagcctcctga
Sequence Length
855
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,176 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 24, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 24
NCBI Official Symbol
ZDHHC24
NCBI Protein Information
probable palmitoyltransferase ZDHHC24
UniProt Protein Name
Probable palmitoyltransferase ZDHHC24
Protein Family
UniProt Gene Name
ZDHHC24
UniProt Synonym Gene Names
DHHC-24
UniProt Entry Name
ZDH24_HUMAN
Uniprot Description
ZDHHC24: Belongs to the DHHC palmitoyltransferase family.
Protein type: Transferase; EC 2.3.1.225; Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 11q13.2
Molecular Function: protein binding
Research Articles on ZDHHC24
Similar Products
Product Notes
The ZDHHC24 zdhhc24 (Catalog #AAA1272667) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcagc cctgggcggc tgggagcacg gacggggcgc ccgcgcagct gcctctcgtg ctcaccgcgc tgtgggccgc ggccgtgggc ctggagctgg cttacgtgct ggtgctcggt cccgggccgc cgccgctggg acccctggcc cgggccttgc agctggcgct ggccgccttc cagctgctca acctgctggg caacgtgggg ctcttcctgc gctcggatcc cagcatccgt ggcgtgatgc tggccggccg cggtctgggc cagggctggg cttactgcta ccaatgccaa agccaggtgc cgccacgcag cggacactgc tctgcctgcc gcgtctgcat cctgcgtcgg gaccaccact gccgcctgct gggccgctgc gtgggcttcg gcaactaccg gcccttcctg tgcctgctgc ttcatgccgc cggcgtcctg ctccacgtct ctgtgctgct gggccctgca ctgtcggccc tgctgcgagc ccacacgccc ctccacatgg ctgccctcct cctgcttccc tggctcatgt tgctcacagg cagagtgtct ctggcacagt ttgccttggc cttcgtgacg gacacgtgcg tggcgggtgc gctgctgtgc ggggctgggc tgctcttcca tgggatgctg ctgctgcggg gccagaccac atgggagtgg gctcggggcc agcactccta tgacctgggt ccctgccaca acctgcaggc agccctgggg ccccgctggg ccctcgtctg gctctggccc ttcctggcct ccccattgcc tggggatggg atcaccttcc agaccacagc agatgtggga cacacagcct cctga. It is sometimes possible for the material contained within the vial of "ZDHHC24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
