Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZCCHC12 cdna clone

ZCCHC12 cDNA Clone

Gene Names
ZCCHC12; SIZN; SIZN1; PNMA7A
Synonyms
ZCCHC12; ZCCHC12 cDNA Clone; ZCCHC12 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagcatcattgcacgtgtcggtaacagccggcggctgaatgcacccttgccgccttgggcccattccatgctgaggtccctggggagaagtctcggtcctataatggccagcatggcagacagaaacatgaagttgttctcggggagggtggtgccagcccaaggggaagaaacctttgaaaactggctgacccaagtcaatggcgtcctgccagattggaatatgtctgaggaggaaaagctcaagcgcttgatgaaaacccttaggggccctgcccgcgaggtcatgcgtgtgcttcaggcgaccaaccctaacctaagtgtggcagatttcttgcgagccatgaaattggtgtttggggagtctgaaagcagtgtgactgcccatggtaaattttttaacaccctacaagctcaaggggagaaagcctccctttatgtgatccgtttagaggtgcagctccagaacgctattcaggcaggcattatagctgagaaagatgcaaaccggactcgcttgcagcagctccttttaggcggtgagctgagtagggacctccgactcagacttaaggattttctcaggatgtatgcaaatgagcaggagcggcttcccaactttctggagttaatcagaatggtaagggaggaagaggattgggatgatgcttttattaaacggaagcgtccaaaaaggtctgagtcaatggtggagagggcagtcagccctgtggcatttcagggctccccaccgatagtgatcggcagtgctgactgcaatgtgatagagatagatgataccctcgacgactccgatgaggatgtgatcctggtggagtctcaggaccctccacttccatcctggggtgcccctcccctcagagacagggccagacctcaggatgaagtgctggtcattgattccccccacaattccagggctcagtttccttccaccagtggtggttctggctataagaataacggtcctggggagatgcgtagagccaggaagcgaaaacacacaatccgctgttcgtattgtggtgaggaaggccactcaaaagaaacctgtgacaacgagagtgacaaggcccaggtttttgagaatttgatcatcactctccaggagctgacccatactgagatggagaggtcaagagtggcccctggcgaatacaatgacttctctgagccactgtaa
Sequence Length
1209
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,369 Da
NCBI Official Full Name
Homo sapiens zinc finger, CCHC domain containing 12, mRNA
NCBI Official Synonym Full Names
zinc finger CCHC-type containing 12
NCBI Official Symbol
ZCCHC12
NCBI Official Synonym Symbols
SIZN; SIZN1; PNMA7A
NCBI Protein Information
zinc finger CCHC domain-containing protein 12
UniProt Protein Name
Zinc finger CCHC domain-containing protein 12
UniProt Gene Name
ZCCHC12
UniProt Synonym Gene Names
SIZN1
UniProt Entry Name
ZCH12_HUMAN

NCBI Description

This gene encodes a downstream effector of bone morphogenetic protein (BMP) signalling. This protein contains a zinc finger domain and functions as a transcriptional coactivator. Variation in this gene may be associated with X-linked mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

Uniprot Description

ZCCHC12: Transcriptional coactivator in the bone morphogenetic protein (BMP)-signaling pathway. It positively modulates BMP signaling by interacting with SMAD1 and associating with CBP in the transcription complex. It contributes to the BMP-induced enhancement of cholinergic-neuron-specific gene expression. Belongs to the ZCCHC12 family.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: Xq24

Cellular Component: nuclear speck

Molecular Function: ligand-dependent nuclear receptor transcription coactivator activity; protein binding

Biological Process: BMP signaling pathway

Research Articles on ZCCHC12

Similar Products

Product Notes

The ZCCHC12 zcchc12 (Catalog #AAA1270371) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagca tcattgcacg tgtcggtaac agccggcggc tgaatgcacc cttgccgcct tgggcccatt ccatgctgag gtccctgggg agaagtctcg gtcctataat ggccagcatg gcagacagaa acatgaagtt gttctcgggg agggtggtgc cagcccaagg ggaagaaacc tttgaaaact ggctgaccca agtcaatggc gtcctgccag attggaatat gtctgaggag gaaaagctca agcgcttgat gaaaaccctt aggggccctg cccgcgaggt catgcgtgtg cttcaggcga ccaaccctaa cctaagtgtg gcagatttct tgcgagccat gaaattggtg tttggggagt ctgaaagcag tgtgactgcc catggtaaat tttttaacac cctacaagct caaggggaga aagcctccct ttatgtgatc cgtttagagg tgcagctcca gaacgctatt caggcaggca ttatagctga gaaagatgca aaccggactc gcttgcagca gctcctttta ggcggtgagc tgagtaggga cctccgactc agacttaagg attttctcag gatgtatgca aatgagcagg agcggcttcc caactttctg gagttaatca gaatggtaag ggaggaagag gattgggatg atgcttttat taaacggaag cgtccaaaaa ggtctgagtc aatggtggag agggcagtca gccctgtggc atttcagggc tccccaccga tagtgatcgg cagtgctgac tgcaatgtga tagagataga tgataccctc gacgactccg atgaggatgt gatcctggtg gagtctcagg accctccact tccatcctgg ggtgcccctc ccctcagaga cagggccaga cctcaggatg aagtgctggt cattgattcc ccccacaatt ccagggctca gtttccttcc accagtggtg gttctggcta taagaataac ggtcctgggg agatgcgtag agccaggaag cgaaaacaca caatccgctg ttcgtattgt ggtgaggaag gccactcaaa agaaacctgt gacaacgaga gtgacaaggc ccaggttttt gagaatttga tcatcactct ccaggagctg acccatactg agatggagag gtcaagagtg gcccctggcg aatacaatga cttctctgag ccactgtaa. It is sometimes possible for the material contained within the vial of "ZCCHC12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.