ZBTB25 cdna clone
ZBTB25 cDNA Clone
Gene Names
ZBTB25; KUP; ZNF46; C14orf51
Synonyms
ZBTB25; ZBTB25 cDNA Clone; ZBTB25 cdna clone
Sequence
atggacactgccagccatagccttgttcttctccagcagctgaacatgcagcgagaatttggttttctgtgtgattgcacagttgcaattggagatgtttacttcaaagcccacagagcagtgcttgctgctttttctaactatttcaagatgatatttattcaccaaacaagtgaatgcataaaaatacaaccaactgacatccaacctgacatattcagctatttgttgcacattatgtacacggggaaagggccaaaacagattgtggatcatagtcgtttggaggaagggattcgatttcttcacgccgactacctttctcacattgcaactgaaatgaatcaagtgttctcaccagagactgtgcagtcctcaaatttatatggcattcagatctcaacaacccaaaaaacagttgtcaaacaaggactggaggtcaaagaagctccttccagtaacagtggaaacagagctgctgtccagggtgaccacccccagttgcagttgtctcttgctattggtctggatgatggcactgcagaccagcagagggcctgtcctgccacccaggccctggaggagcaccagaagcccccagtttccatcaagcaggagagatgtgacccagaatctgtgatctcccagagccacccctcaccctcatcagaggtgacaggccccacttttactgaaaacagtgtcaaaatacacttatgccattactgtggggaacgttttgattcccgtagtaacctaaggcaacatctccatacacatgtgtctggatccctgccattcggtgtccctgcttccattctggaaagtaatgaccttggtgaagtgcatccccttaatgaaaacagcgaggcccttgaatgccgcaggctcagctccttcattgttaaggagaatgaacagcagccagaccacaccaaccggggtaccacagagcctttgcagatcagtcaagtatctttgatctccaaagacacagagccagtagaattaaactgtaatttttctttttcaaggaaaagaaaaatgagctgtaccatctgtggtcataaattccctcgaaagagccaattgttggaacacatgtatacacacaaaggtaaatcttacagatataaccgatgccaaaggtttggtaatgcattggcccagagatttcagccatactgtgacagctggtctgatgtctccctgaaaagttctcgcttgtcacaagaacacttagacttgccttgtgccttagagtcagagctcacacaagaaaatgtggatactatcctagttgagtag
Sequence Length
1308
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,990 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 25, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 25
NCBI Official Symbol
ZBTB25
NCBI Official Synonym Symbols
KUP; ZNF46; C14orf51
NCBI Protein Information
zinc finger and BTB domain-containing protein 25
UniProt Protein Name
Zinc finger and BTB domain-containing protein 25
Protein Family
UniProt Gene Name
ZBTB25
UniProt Synonym Gene Names
C14orf51; KUP; ZNF46
UniProt Entry Name
ZBT25_HUMAN
Uniprot Description
ZBTB25: May be involved in transcriptional regulation.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 14q23-q24
Cellular Component: cytoplasm; nucleoplasm
Molecular Function: DNA binding; protein binding; transcription factor activity
Biological Process: gene expression
Research Articles on ZBTB25
Similar Products
Product Notes
The ZBTB25 zbtb25 (Catalog #AAA1273676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacactg ccagccatag ccttgttctt ctccagcagc tgaacatgca gcgagaattt ggttttctgt gtgattgcac agttgcaatt ggagatgttt acttcaaagc ccacagagca gtgcttgctg ctttttctaa ctatttcaag atgatattta ttcaccaaac aagtgaatgc ataaaaatac aaccaactga catccaacct gacatattca gctatttgtt gcacattatg tacacgggga aagggccaaa acagattgtg gatcatagtc gtttggagga agggattcga tttcttcacg ccgactacct ttctcacatt gcaactgaaa tgaatcaagt gttctcacca gagactgtgc agtcctcaaa tttatatggc attcagatct caacaaccca aaaaacagtt gtcaaacaag gactggaggt caaagaagct ccttccagta acagtggaaa cagagctgct gtccagggtg accaccccca gttgcagttg tctcttgcta ttggtctgga tgatggcact gcagaccagc agagggcctg tcctgccacc caggccctgg aggagcacca gaagccccca gtttccatca agcaggagag atgtgaccca gaatctgtga tctcccagag ccacccctca ccctcatcag aggtgacagg ccccactttt actgaaaaca gtgtcaaaat acacttatgc cattactgtg gggaacgttt tgattcccgt agtaacctaa ggcaacatct ccatacacat gtgtctggat ccctgccatt cggtgtccct gcttccattc tggaaagtaa tgaccttggt gaagtgcatc cccttaatga aaacagcgag gcccttgaat gccgcaggct cagctccttc attgttaagg agaatgaaca gcagccagac cacaccaacc ggggtaccac agagcctttg cagatcagtc aagtatcttt gatctccaaa gacacagagc cagtagaatt aaactgtaat ttttcttttt caaggaaaag aaaaatgagc tgtaccatct gtggtcataa attccctcga aagagccaat tgttggaaca catgtataca cacaaaggta aatcttacag atataaccga tgccaaaggt ttggtaatgc attggcccag agatttcagc catactgtga cagctggtct gatgtctccc tgaaaagttc tcgcttgtca caagaacact tagacttgcc ttgtgcctta gagtcagagc tcacacaaga aaatgtggat actatcctag ttgagtag. It is sometimes possible for the material contained within the vial of "ZBTB25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
