Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB24 cdna clone

ZBTB24 cDNA Clone

Gene Names
ZBTB24; BIF1; ICF2; PATZ2; ZNF450
Synonyms
ZBTB24; ZBTB24 cDNA Clone; ZBTB24 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaaacatcgccagagccttctgggcagcttgttgtacactcagacgctcacagtgacactgtgctggccagttttgaggatcagaggaagaaaggcttcctctgtgacattactttaatcgtggagaatgtacatttccgggcccacaaagccttacttgctgccagtagtgaatacttctcaatgatgtttgcagaagagggggaaatcggccaatccatttatatgctggaaggcatggttgcagacacctttggtatcctgctggaatttatctacacaggttatctccatgccagtgagaaaagtacagaacaaatcctggctactgctcagttcttaaaagtctatgacctggtaaaggcttacacagacttccaaaataatcatagctccccaaagccaacaactttgaacactgctggtgccccagtggttgttatctctaataagaaaaacgatcctccaaagcggaaacggggaagaccaaaaaaagtcaatacattgcaggaggagaaatcagaactggctgcagaggaagaaatacagttaagagtgaacaattcagttcagaatagacaaaactttgtggttaaaggagacagtggtgtactgaatgagcaaattgcagcaaaagaaaaggaagaatcggagcctacttgtgagccaagtagagaggaggaaatgccagttgaaaaagatgagaactatgatcccaagaccgaggatggccaggcaagccagagtcgatacagcaagcggaggatttggagatccgtcaaacttaaagattacaaacttgttggggatcaagaggaccatggttcagccaagaggatctgtggaaggagaaagcgccctggaggccctgaggcccgctgtaaagactgtggcaaggtctttaagtacaatcactttttagcaatccaccagaggagccacacaggtaatgatgttttcaaagctgattgcagtgtgttgcagaattgggagtag
Sequence Length
1002
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,620 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 24, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 24
NCBI Official Symbol
ZBTB24
NCBI Official Synonym Symbols
BIF1; ICF2; PATZ2; ZNF450
NCBI Protein Information
zinc finger and BTB domain-containing protein 24
UniProt Protein Name
Zinc finger and BTB domain-containing protein 24
UniProt Gene Name
ZBTB24
UniProt Synonym Gene Names
KIAA0441; ZNF450
UniProt Entry Name
ZBT24_HUMAN

NCBI Description

This gene encodes a protein similar to a protein in rodents which is induced by bone morphogenic protein 2 in vitro. [provided by RefSeq, Aug 2011]

Uniprot Description

ZBTB24: May be involved in BMP2-induced transcription. Defects in ZBTB24 are the cause of immunodeficiency- centromeric instability-facial anomalies syndrome type 2 (ICF2). A rare disorder characterized by a variable immunodeficiency resulting in recurrent infections, facial anomalies, and branching of chromosomes 1, 9, and 16. Other variable symptoms include growth retardation, failure to thrive, and psychomotor retardation. Laboratory studies show limited hypomethylation of DNA in a small fraction of the genome in some, but not all, patients. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 6q21

Molecular Function: protein binding

Disease: Immunodeficiency-centromeric Instability-facial Anomalies Syndrome 2

Research Articles on ZBTB24

Similar Products

Product Notes

The ZBTB24 zbtb24 (Catalog #AAA1269524) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaaa catcgccaga gccttctggg cagcttgttg tacactcaga cgctcacagt gacactgtgc tggccagttt tgaggatcag aggaagaaag gcttcctctg tgacattact ttaatcgtgg agaatgtaca tttccgggcc cacaaagcct tacttgctgc cagtagtgaa tacttctcaa tgatgtttgc agaagagggg gaaatcggcc aatccattta tatgctggaa ggcatggttg cagacacctt tggtatcctg ctggaattta tctacacagg ttatctccat gccagtgaga aaagtacaga acaaatcctg gctactgctc agttcttaaa agtctatgac ctggtaaagg cttacacaga cttccaaaat aatcatagct ccccaaagcc aacaactttg aacactgctg gtgccccagt ggttgttatc tctaataaga aaaacgatcc tccaaagcgg aaacggggaa gaccaaaaaa agtcaataca ttgcaggagg agaaatcaga actggctgca gaggaagaaa tacagttaag agtgaacaat tcagttcaga atagacaaaa ctttgtggtt aaaggagaca gtggtgtact gaatgagcaa attgcagcaa aagaaaagga agaatcggag cctacttgtg agccaagtag agaggaggaa atgccagttg aaaaagatga gaactatgat cccaagaccg aggatggcca ggcaagccag agtcgataca gcaagcggag gatttggaga tccgtcaaac ttaaagatta caaacttgtt ggggatcaag aggaccatgg ttcagccaag aggatctgtg gaaggagaaa gcgccctgga ggccctgagg cccgctgtaa agactgtggc aaggtcttta agtacaatca ctttttagca atccaccaga ggagccacac aggtaatgat gttttcaaag ctgattgcag tgtgttgcag aattgggagt ag. It is sometimes possible for the material contained within the vial of "ZBTB24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.