Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB1 cdna clone

ZBTB1 cDNA Clone

Gene Names
ZBTB1; ZNF909
Synonyms
ZBTB1; ZBTB1 cDNA Clone; ZBTB1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaagcccagccacagcagctatgtccttcagcagctaaacaaccaaagagaatggggttttctctgtgactgctgtattgcaattgatgacatttactttcaagcacacaaggcagttctagctgcctgtagctcctattttagaatgtttttcatgaaccatcagcatagtactgcacaactgaatctcagcaacatgaaaattagtgcagaatgttttgatctcattttgcagtttatgtatttaggaaaaattatgacagctccctccagttttgagcagtttaaagtggcaatgaactacctacagctatacaatgttcctgactgtttagaagacatccaggatgcagattgttctagttcaaaatgttcctcttctgcttccagcaaacagaacagcaaaatgatatttggggtaagaatgtatgaagatactgtggctcgaaatggcaatgaagccaacaggtggtgtgcagagccaagttcaacggtaaatacaccacataatagagaggctgatgaagagtctttacaattaggtaattttcctgagccactatttgatgtatgtaaaaaaagttccgtgtccaaattatctactccaaaagaacgtgtgtcaagacgctttgggcggagttttacctgtgatagctgtggatttggctttagctgtgaaaaattattagatgagcatgtgctaacctgtactaacagacatttataccaaaacacaagatcttaccatagaatagtagatattagagatggaaaagacagtaacatcaaagctgaatttggtgaaaaagattcttccaaaacattttctgcacagacggacaaatacagaggagacacaagccaggctgctgatgattcagcttcaaccactggaagcagaaaaagtagcacagtggagtctgaaatagcaagcgaagagaaaagcagagctgctgagaggaaaaggattattattaagatggagccagaagatactcctacagatgaactgaaagactttaacattattaaagttactgataaagactgtaatgaatccactgacaatgatgaattagaagatgaacctgaagagccattttatagatactatgttgaagaagatgtcagcataaaaaaaagtggtaggaaaactctaaaacctcgaatgtcagtaagtgctgatgaaagaggtggtttagagaatatgaggccccctaacaacagcagtccagtacaagaggatgctgaaaatgcatcttgtgagctgtgtggacttacaataaccgaggaggacctgtcatctcattacttagccaaacacattgaaaatatctgtgcatgtggtaaatgtggacaaatacttgtaaagggtaggcagcttcaggaacatgctcaacgatgtggcgagccccaagatctgaccatgaatgggttaggaaatactgaggagaaaatggacttggaagagaatcctgatgagcagtccgaaataagagatatgtttgttgaaatgctggatgattttagggacaatcattaccagataaacagtatccaaaaaaagcagttatttaaacattctgcctgcccttttcgatgtcctaattgtggccagcgttttgaaactgaaaatctagtggttgaacatatgtctagctgcttagatcaagatatgtttaagagtgccatcatggaagaaaatgaaagagatcacagacgaaagcatttttgtaatctgtgtggaaaaggattttatcagcggtgtcacttaagagaacactatactgttcatactaaggaaaaacagtttgtttgtcaaacatgtggaaagcagtttttaagagagcgtcagttgcgactgcacaatgatatgcacaaaggcatggccaggtatgtctgttccatttgtgatcaaggaaacttcagaaaacatgaccatgtacggcatatgatttctcatttatctgctggtgagactatatgccaggtctgctttcagatattcccaaataatgaacagttggagcagcacatggatgttcatctgtatacatgtggaatatgtggagcaaaatttaatttgaggaaagatatgagatcacattataatgccaagcatttgaaaagaacctga
Sequence Length
2142
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,682 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 1, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 1
NCBI Official Symbol
ZBTB1
NCBI Official Synonym Symbols
ZNF909
NCBI Protein Information
zinc finger and BTB domain-containing protein 1
UniProt Protein Name
Zinc finger and BTB domain-containing protein 1
UniProt Gene Name
ZBTB1
UniProt Synonym Gene Names
KIAA0997
UniProt Entry Name
ZBTB1_HUMAN

Uniprot Description

ZBTB1: May be involved in transcriptional regulation. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 14q23.3

Cellular Component: nuclear body; nucleoplasm; nucleus

Molecular Function: protein binding; protein heterodimerization activity; protein homodimerization activity

Biological Process: bypass DNA synthesis; chromatin remodeling; DNA repair; mRNA transcription from RNA polymerase II promoter; negative regulation of transcription from RNA polymerase II promoter; positive regulation of natural killer cell differentiation; positive regulation of T cell differentiation; positive regulation of T cell mediated immunity; protein homooligomerization; response to DNA damage stimulus; thymus development

Research Articles on ZBTB1

Similar Products

Product Notes

The ZBTB1 zbtb1 (Catalog #AAA1268098) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaagc ccagccacag cagctatgtc cttcagcagc taaacaacca aagagaatgg ggttttctct gtgactgctg tattgcaatt gatgacattt actttcaagc acacaaggca gttctagctg cctgtagctc ctattttaga atgtttttca tgaaccatca gcatagtact gcacaactga atctcagcaa catgaaaatt agtgcagaat gttttgatct cattttgcag tttatgtatt taggaaaaat tatgacagct ccctccagtt ttgagcagtt taaagtggca atgaactacc tacagctata caatgttcct gactgtttag aagacatcca ggatgcagat tgttctagtt caaaatgttc ctcttctgct tccagcaaac agaacagcaa aatgatattt ggggtaagaa tgtatgaaga tactgtggct cgaaatggca atgaagccaa caggtggtgt gcagagccaa gttcaacggt aaatacacca cataatagag aggctgatga agagtcttta caattaggta attttcctga gccactattt gatgtatgta aaaaaagttc cgtgtccaaa ttatctactc caaaagaacg tgtgtcaaga cgctttgggc ggagttttac ctgtgatagc tgtggatttg gctttagctg tgaaaaatta ttagatgagc atgtgctaac ctgtactaac agacatttat accaaaacac aagatcttac catagaatag tagatattag agatggaaaa gacagtaaca tcaaagctga atttggtgaa aaagattctt ccaaaacatt ttctgcacag acggacaaat acagaggaga cacaagccag gctgctgatg attcagcttc aaccactgga agcagaaaaa gtagcacagt ggagtctgaa atagcaagcg aagagaaaag cagagctgct gagaggaaaa ggattattat taagatggag ccagaagata ctcctacaga tgaactgaaa gactttaaca ttattaaagt tactgataaa gactgtaatg aatccactga caatgatgaa ttagaagatg aacctgaaga gccattttat agatactatg ttgaagaaga tgtcagcata aaaaaaagtg gtaggaaaac tctaaaacct cgaatgtcag taagtgctga tgaaagaggt ggtttagaga atatgaggcc ccctaacaac agcagtccag tacaagagga tgctgaaaat gcatcttgtg agctgtgtgg acttacaata accgaggagg acctgtcatc tcattactta gccaaacaca ttgaaaatat ctgtgcatgt ggtaaatgtg gacaaatact tgtaaagggt aggcagcttc aggaacatgc tcaacgatgt ggcgagcccc aagatctgac catgaatggg ttaggaaata ctgaggagaa aatggacttg gaagagaatc ctgatgagca gtccgaaata agagatatgt ttgttgaaat gctggatgat tttagggaca atcattacca gataaacagt atccaaaaaa agcagttatt taaacattct gcctgccctt ttcgatgtcc taattgtggc cagcgttttg aaactgaaaa tctagtggtt gaacatatgt ctagctgctt agatcaagat atgtttaaga gtgccatcat ggaagaaaat gaaagagatc acagacgaaa gcatttttgt aatctgtgtg gaaaaggatt ttatcagcgg tgtcacttaa gagaacacta tactgttcat actaaggaaa aacagtttgt ttgtcaaaca tgtggaaagc agtttttaag agagcgtcag ttgcgactgc acaatgatat gcacaaaggc atggccaggt atgtctgttc catttgtgat caaggaaact tcagaaaaca tgaccatgta cggcatatga tttctcattt atctgctggt gagactatat gccaggtctg ctttcagata ttcccaaata atgaacagtt ggagcagcac atggatgttc atctgtatac atgtggaata tgtggagcaa aatttaattt gaggaaagat atgagatcac attataatgc caagcatttg aaaagaacct ga. It is sometimes possible for the material contained within the vial of "ZBTB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.