Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

YWHAQ cdna clone

YWHAQ cDNA Clone

Gene Names
YWHAQ; 1C5; HS1; 14-3-3
Synonyms
YWHAQ; YWHAQ cDNA Clone; YWHAQ cdna clone
Ordering
For Research Use Only!
Sequence
atggagaagactgagctgatccagaaggccaagctggccgagcaggccgagcgctacgacgacatggccacctgcatgaaggcagtgaccgagcagggcgccgagctgtccaacgaggagcgcaacctgctctccgtggcctacaagaacgtggtcgggggccgcaggtccgcctggagggtcatctctagcatcgagcagaagaccgacacctccgacaagaagttgcagctgattaaggactatcgggagaaagtggagtccgagctgagatccatctgcaccacggtgctggaattgttggataaatatttaatagccaatgcaactaatccagagagtaaggtcttctatctgaaaatgaagggtgattacttccggtaccttgctgaagttgcgtgtggtgatgatcgaaaacaaacgatagataattcccaaggagcttaccaagaggcatttgatataagcaagaaagagatgcaacccacacacccaatccgcctggggcttgctcttaacttttctgtattttactatgagattcttaataacccagagcttgcctgcacgctggctaaaacggcttttgatgaggccattgctgaacttgatacactgaatgaagactcatacaaagacagcaccctcatcatgcagttgcttagagacaacctaacactttggacatcagacagtgcaggagaagaatgtgatgcggcagaaggggctgaaaactaa
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,764 Da
NCBI Official Full Name
Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide, mRNA
NCBI Official Synonym Full Names
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta
NCBI Official Symbol
YWHAQ
NCBI Official Synonym Symbols
1C5; HS1; 14-3-3
NCBI Protein Information
14-3-3 protein theta
UniProt Protein Name
14-3-3 protein theta
Protein Family
UniProt Gene Name
YWHAQ
UniProt Entry Name
1433T_HUMAN

NCBI Description

This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse and rat orthologs. This gene is upregulated in patients with amyotrophic lateral sclerosis. It contains in its 5' UTR a 6 bp tandem repeat sequence which is polymorphic, however, there is no correlation between the repeat number and the disease. [provided by RefSeq, Jul 2008]

Uniprot Description

14-3-3 theta: a protein of the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. A multifunctional regulator of the cell signaling processes. Associates with c-BCR and BCR-Abl.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 2p25.1

Cellular Component: cytoplasm; cytoplasmic vesicle membrane; cytosol; focal adhesion; membrane; protein complex

Molecular Function: protein binding; protein N-terminus binding

Biological Process: negative regulation of transcription, DNA-dependent; substantia nigra development

Research Articles on YWHAQ

Similar Products

Product Notes

The YWHAQ ywhaq (Catalog #AAA1269256) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaga ctgagctgat ccagaaggcc aagctggccg agcaggccga gcgctacgac gacatggcca cctgcatgaa ggcagtgacc gagcagggcg ccgagctgtc caacgaggag cgcaacctgc tctccgtggc ctacaagaac gtggtcgggg gccgcaggtc cgcctggagg gtcatctcta gcatcgagca gaagaccgac acctccgaca agaagttgca gctgattaag gactatcggg agaaagtgga gtccgagctg agatccatct gcaccacggt gctggaattg ttggataaat atttaatagc caatgcaact aatccagaga gtaaggtctt ctatctgaaa atgaagggtg attacttccg gtaccttgct gaagttgcgt gtggtgatga tcgaaaacaa acgatagata attcccaagg agcttaccaa gaggcatttg atataagcaa gaaagagatg caacccacac acccaatccg cctggggctt gctcttaact tttctgtatt ttactatgag attcttaata acccagagct tgcctgcacg ctggctaaaa cggcttttga tgaggccatt gctgaacttg atacactgaa tgaagactca tacaaagaca gcaccctcat catgcagttg cttagagaca acctaacact ttggacatca gacagtgcag gagaagaatg tgatgcggca gaaggggctg aaaactaa. It is sometimes possible for the material contained within the vial of "YWHAQ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.