Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

YWHAB cdna clone

YWHAB cDNA Clone

Gene Names
YWHAB; HS1; GW128; YWHAA; KCIP-1; HEL-S-1
Synonyms
YWHAB; YWHAB cDNA Clone; YWHAB cdna clone
Ordering
For Research Use Only!
Sequence
atgaatgaccttatctgtttcctggataatacctttaagaataatgtcctgagtcaggcgtggtggtgcgtgcatctagtcccaactatttgggaggctgaggcaggaggatcgcttgagcccaggagtttaaagctgcagtgccctgtggttgcacctgtgaataactgcactccagcctgggcaacatag
Sequence Length
192
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,850 Da
NCBI Official Full Name
Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide, mRNA
NCBI Official Synonym Full Names
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta
NCBI Official Symbol
YWHAB
NCBI Official Synonym Symbols
HS1; GW128; YWHAA; KCIP-1; HEL-S-1
NCBI Protein Information
14-3-3 protein beta/alpha
UniProt Protein Name
14-3-3 protein beta/alpha
Protein Family
UniProt Gene Name
YWHAB
UniProt Synonym Gene Names
KCIP-1
UniProt Entry Name
1433B_HUMAN

NCBI Description

This gene encodes a protein belonging to the 14-3-3 family of proteins, members of which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals. The encoded protein has been shown to interact with RAF1 and CDC25 phosphatases, suggesting that it may play a role in linking mitogenic signaling and the cell cycle machinery. Two transcript variants, which encode the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

14-3-3 beta: a protein of the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. A multifunctional regulator of the cell signaling processes.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 20q13.1

Cellular Component: cell-cell adherens junction; cytoplasm; cytoplasmic vesicle membrane; cytosol; focal adhesion; membrane; perinuclear region of cytoplasm

Molecular Function: enzyme binding; histone deacetylase binding; phosphoprotein binding; phosphoserine binding; protein binding; protein domain specific binding

Biological Process: cytoplasmic sequestering of protein; MAPKKK cascade; negative regulation of G-protein coupled receptor protein signaling pathway; negative regulation of protein amino acid dephosphorylation; positive regulation of catalytic activity; regulation of mRNA stability

Research Articles on YWHAB

Similar Products

Product Notes

The YWHAB ywhab (Catalog #AAA1273536) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaatgacc ttatctgttt cctggataat acctttaaga ataatgtcct gagtcaggcg tggtggtgcg tgcatctagt cccaactatt tgggaggctg aggcaggagg atcgcttgag cccaggagtt taaagctgca gtgccctgtg gttgcacctg tgaataactg cactccagcc tgggcaacat ag. It is sometimes possible for the material contained within the vial of "YWHAB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.