YPEL2 cdna clone
YPEL2 cDNA Clone
Gene Names
YPEL2; FKSG4
Synonyms
YPEL2; YPEL2 cDNA Clone; YPEL2 cdna clone
Sequence
atggtgaagatgacaagatcgaagactttccaggcatatctgccctcctgccaccggacctacagctgcattcactgcagagctcacttggccaatcatgatgaactaatttccaagtcattccaaggaagtcaaggacgagcatacctctttaactcagtagttaatgtgggctgtgggcctgcagaagagcgagtgttgctaacaggactgcatgcagtcgcagacatttactgtgaaaactgcaaaaccactctgggctggaaatacgaacatgcttttgaaagcagccagaaatataaagaaggcaaatacatcattgaactagcacacatgatcaaggacaatggctgggactga
Sequence Length
360
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
13,577 Da
NCBI Official Full Name
Homo sapiens yippee-like 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
yippee like 2
NCBI Official Symbol
YPEL2
NCBI Official Synonym Symbols
FKSG4
NCBI Protein Information
protein yippee-like 2
UniProt Protein Name
Protein yippee-like 2
Protein Family
UniProt Gene Name
YPEL2
UniProt Entry Name
YPEL2_HUMAN
Uniprot Description
YPEL2: Belongs to the yippee family.
Protein type: Nucleolus; Cell cycle regulation
Chromosomal Location of Human Ortholog: 17q22
Research Articles on YPEL2
1. Observational study of gene-disease association and gene-environment interaction. (HuGE Navigator)
Similar Products
Product Notes
The YPEL2 ypel2 (Catalog #AAA1267410) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaaga tgacaagatc gaagactttc caggcatatc tgccctcctg ccaccggacc tacagctgca ttcactgcag agctcacttg gccaatcatg atgaactaat ttccaagtca ttccaaggaa gtcaaggacg agcatacctc tttaactcag tagttaatgt gggctgtggg cctgcagaag agcgagtgtt gctaacagga ctgcatgcag tcgcagacat ttactgtgaa aactgcaaaa ccactctggg ctggaaatac gaacatgctt ttgaaagcag ccagaaatat aaagaaggca aatacatcat tgaactagca cacatgatca aggacaatgg ctgggactga. It is sometimes possible for the material contained within the vial of "YPEL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
