Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Vector Map

XPO1 cdna clone

XPO1 cDNA Clone

Gene Names
XPO1; emb; CRM1; exp1
Synonyms
XPO1; XPO1 cDNA Clone; XPO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagcaattatgacaatgttagcagaccatgcagctcgtcagctgcttgatttcagccaaaaactggatatcaacttattagataatgtggtgaattgcttataccatggagaaggagcccagcaaagaatggctcaagaagtactgacacatttaaaggagcatcctgatgcttggacaagagtcgacacaattttggaattttctcagaatatgaatacgaaatactatggactacaaattttggaaaatgtgataaaaacaaggtggaagattcttccaaggaaccagtgcgaaggaataaaaaaatacgttgttggcctcattatcaagacgtcatctgacccaacttgtgtagagaaagaaaaggtgtatatcggaaaattaaatatgatccttgttcagatactgaaacaagaatggcccaaacattggccaacttttatcagtgatattgttggagcaagtaggaccagcgaaagtctctgtcaaaataatatggtgattcttaaactcttgagtgaagaagtatttgatttctctagtggacagataacccaagtcaaatctaagcatttaaaagacagcatgtgcaatgaattctcacagatatttcaactgtgtcagtttgtaatggaaaattctcaaaatgctccacttgtacatgcaaccttggaaacattgctcagatttctgaactggattcccctgggatatatttttgagaccaaattaatcagcacattgatttataagttcctgaatgttccaatgtttcgaaatgtctctctgaagtgcctcactgagattgctggtgtgagtgtaagccaatatgaagaacaatttgtaacactatttactctgacaatgatgcaactaaagcagatgcttcctttaaataccaatattcgacttgcgtactcaaatggaaaagatgatgaacagaacttcattcaaaatctcagtttgtttctctgcacctttcttaaggaacatgatcaacttatagaaaaaagattaaatctcagggaaactcttatggaggcccttcattatatgttgttggtatctgaagtagaagaaactgaaatctttaaaatttgtcttgaatactggaatcatttggctgctgaactctatagagagagtccattctctacatctgcctctccgttgctttctggaagtcaacattttgatgttcctcccaggagacagctatatttgcccatgttattcaaggtccgtttattaatggttagtcgaatggctaaaccagaggaagtattggttgtagagaatgatcaaggagaagttgtgagagaattcatgaaggatacagattccataaatttgtataagaatatgagggaaacattggtttatcttactcatctggattatgtagatacagaaagaataatgacagagaagcttcacaatcaagtgaatggtacagagtggtcatggaaaaatttgaatacattgtgttgggcaataggctccattagtggagcaatgcatgaagaggacgaaaaacgatttcttgttactgttataaaggatctattaggattatgtgaacagaaaagaggcaaagataataaagctattattgcatcaaatatcatgtacatagtaggtcaatacccacgttttttgagagctcactggaaatttctgaagactgtagttaacaagctgttcgaattcatgcatgagacccatgatggagtccaggatatggcttgtgatactttcattaaaatagcccaaaaatgccgcaggcatttcgttcaggttcaggttggagaagtgatgccatttattgatgaaattttgaacaacattaacactattatttgtgatcttcagcctcaacaggttcatacgttttatgaagctgtggggtacatgattggtgcacaaacagatcaaacagtacaagaacacttgatagaaaagtacatgttactccctaatcaagtgtgggatagtataatccagcaggcaaccaaaaatgtggatatactgaaagatcctgaaacagtcaagcagcttggtagcattttgaaaacaaatgtgagagcctgcaaagctgttggacacccctttgtaattcagcttggaagaatttatttagatatgcttaatgtatacaagtgcctcagtgaaaatatttctgcagctatccaagctaatggtgaaatggttacaaagcaaccattgattagaagtatgcgaactgtaaaaagggaaactttaaagttaatatctggttgggtgagccgatccaatgatccacagatggtcgctgaaaattttgttccccctctgttggatgcagttctcattgattatcagagaaatgtcccagctgctagagaaccagaagtgcttagtactatggccataattgtcaacaagttagggggacatataacagctgaaatacctcaaatatttgatgctgtttttgaatgcacattgaatatgataaataaggactttgaagaatatcctgaacatagaacgaactttttcttactacttcaggctgtcaattctcattgtttcccagcattccttgctattccacctacacagtttaaacttgttttggattccatcatttgggctttcaaacatactatgaggaatgtcgcagatacgggcttacagatactttttacactcttacaaaatgttgcacaagaagaagctgcagctcagagtttttatcaaacttatttttgtgatattctccagcatatcttttctgttgtgacagacacttcacatactgctggtttaacaatgcatgcatcaattcttgcatatatgtttaatttggttgaagaaggaaaaataagtacatcattaaatcctggaaatccagttaacaaccaaatctttcttcaggaatatgtggctaatctccttaagtcggccttccctcacctacaagatgctcaagtaaagctctttgtgacagggcttttcagcttaaatcaagatattcctgctttcaaggaacatttaagagatttcctagttcaaataaaggaatttgcaggtgaagacacttctgatttgtttttggaagagagagaaatagccctacggcaggctgatgaagagaaacataaacgtcaaatgtctgtccctggcatctttaatccacatgagattccagaagaaatgtgtgattaa
Sequence Length
3216
Vector
pUC
Clone Sequence Report
Provided with product shipment

Vector Map

Vector Map

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
123,386 Da
NCBI Official Full Name
Homo sapiens exportin 1 (CRM1 homolog, yeast), mRNA
NCBI Official Synonym Full Names
exportin 1
NCBI Official Symbol
XPO1
NCBI Official Synonym Symbols
emb; CRM1; exp1
NCBI Protein Information
exportin-1
UniProt Protein Name
Exportin-1
Protein Family
UniProt Gene Name
XPO1
UniProt Synonym Gene Names
CRM1; Exp1
UniProt Entry Name
XPO1_HUMAN

NCBI Description

This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Uniprot Description

Exportin-1: Mediates the nuclear export of cellular proteins (cargos) bearing a leucine-rich nuclear export signal (NES) and of RNAs. In the nucleus, in association with RANBP3, binds cooperatively to the NES on its target protein and to the GTPase RAN in its active GTP-bound form (Ran-GTP). Docking of this complex to the nuclear pore complex (NPC) is mediated through binding to nucleoporins. Upon transit of an nuclear export complex into the cytoplasm, disassembling of the complex and hydrolysis of Ran-GTP to Ran-GDP (induced by RANBP1 and RANGAP1, respectively) cause release of the cargo from the export receptor. The directionality of nuclear export is thought to be conferred by an asymmetric distribution of the GTP- and GDP-bound forms of Ran between the cytoplasm and nucleus. Involved in U3 snoRNA transport from Cajal bodies to nucleoli. Binds to late precursor U3 snoRNA bearing a TMG cap. Several viruses, among them HIV-1, HTLV-1 and influenza A use it to export their unspliced or incompletely spliced RNAs out of the nucleus. Interacts with, and mediates the nuclear export of HIV-1 Rev and HTLV-1 Rex proteins. Involved in HTLV-1 Rex multimerization. Belongs to the exportin family.

Protein type: Nuclear import; Nucleolus; Karyopherin; Nuclear export

Chromosomal Location of Human Ortholog: 2p15

Cellular Component: annulate lamellae; cytoplasm; cytosol; intracellular membrane-bound organelle; kinetochore; membrane; nuclear envelope; nuclear membrane; nucleoplasm; nucleus; ribonucleoprotein complex

Molecular Function: nuclear export signal receptor activity; nucleocytoplasmic transporter activity; protein binding; transporter activity

Biological Process: protein export from nucleus; regulation of mRNA stability; regulation of protein export from nucleus; ribosomal large subunit export from nucleus; ribosomal small subunit export from nucleus; sister chromatid cohesion; viral reproduction

Research Articles on XPO1

Similar Products

Product Notes

The XPO1 xpo1 (Catalog #AAA1269620) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagcaa ttatgacaat gttagcagac catgcagctc gtcagctgct tgatttcagc caaaaactgg atatcaactt attagataat gtggtgaatt gcttatacca tggagaagga gcccagcaaa gaatggctca agaagtactg acacatttaa aggagcatcc tgatgcttgg acaagagtcg acacaatttt ggaattttct cagaatatga atacgaaata ctatggacta caaattttgg aaaatgtgat aaaaacaagg tggaagattc ttccaaggaa ccagtgcgaa ggaataaaaa aatacgttgt tggcctcatt atcaagacgt catctgaccc aacttgtgta gagaaagaaa aggtgtatat cggaaaatta aatatgatcc ttgttcagat actgaaacaa gaatggccca aacattggcc aacttttatc agtgatattg ttggagcaag taggaccagc gaaagtctct gtcaaaataa tatggtgatt cttaaactct tgagtgaaga agtatttgat ttctctagtg gacagataac ccaagtcaaa tctaagcatt taaaagacag catgtgcaat gaattctcac agatatttca actgtgtcag tttgtaatgg aaaattctca aaatgctcca cttgtacatg caaccttgga aacattgctc agatttctga actggattcc cctgggatat atttttgaga ccaaattaat cagcacattg atttataagt tcctgaatgt tccaatgttt cgaaatgtct ctctgaagtg cctcactgag attgctggtg tgagtgtaag ccaatatgaa gaacaatttg taacactatt tactctgaca atgatgcaac taaagcagat gcttccttta aataccaata ttcgacttgc gtactcaaat ggaaaagatg atgaacagaa cttcattcaa aatctcagtt tgtttctctg cacctttctt aaggaacatg atcaacttat agaaaaaaga ttaaatctca gggaaactct tatggaggcc cttcattata tgttgttggt atctgaagta gaagaaactg aaatctttaa aatttgtctt gaatactgga atcatttggc tgctgaactc tatagagaga gtccattctc tacatctgcc tctccgttgc tttctggaag tcaacatttt gatgttcctc ccaggagaca gctatatttg cccatgttat tcaaggtccg tttattaatg gttagtcgaa tggctaaacc agaggaagta ttggttgtag agaatgatca aggagaagtt gtgagagaat tcatgaagga tacagattcc ataaatttgt ataagaatat gagggaaaca ttggtttatc ttactcatct ggattatgta gatacagaaa gaataatgac agagaagctt cacaatcaag tgaatggtac agagtggtca tggaaaaatt tgaatacatt gtgttgggca ataggctcca ttagtggagc aatgcatgaa gaggacgaaa aacgatttct tgttactgtt ataaaggatc tattaggatt atgtgaacag aaaagaggca aagataataa agctattatt gcatcaaata tcatgtacat agtaggtcaa tacccacgtt ttttgagagc tcactggaaa tttctgaaga ctgtagttaa caagctgttc gaattcatgc atgagaccca tgatggagtc caggatatgg cttgtgatac tttcattaaa atagcccaaa aatgccgcag gcatttcgtt caggttcagg ttggagaagt gatgccattt attgatgaaa ttttgaacaa cattaacact attatttgtg atcttcagcc tcaacaggtt catacgtttt atgaagctgt ggggtacatg attggtgcac aaacagatca aacagtacaa gaacacttga tagaaaagta catgttactc cctaatcaag tgtgggatag tataatccag caggcaacca aaaatgtgga tatactgaaa gatcctgaaa cagtcaagca gcttggtagc attttgaaaa caaatgtgag agcctgcaaa gctgttggac acccctttgt aattcagctt ggaagaattt atttagatat gcttaatgta tacaagtgcc tcagtgaaaa tatttctgca gctatccaag ctaatggtga aatggttaca aagcaaccat tgattagaag tatgcgaact gtaaaaaggg aaactttaaa gttaatatct ggttgggtga gccgatccaa tgatccacag atggtcgctg aaaattttgt tccccctctg ttggatgcag ttctcattga ttatcagaga aatgtcccag ctgctagaga accagaagtg cttagtacta tggccataat tgtcaacaag ttagggggac atataacagc tgaaatacct caaatatttg atgctgtttt tgaatgcaca ttgaatatga taaataagga ctttgaagaa tatcctgaac atagaacgaa ctttttctta ctacttcagg ctgtcaattc tcattgtttc ccagcattcc ttgctattcc acctacacag tttaaacttg ttttggattc catcatttgg gctttcaaac atactatgag gaatgtcgca gatacgggct tacagatact ttttacactc ttacaaaatg ttgcacaaga agaagctgca gctcagagtt tttatcaaac ttatttttgt gatattctcc agcatatctt ttctgttgtg acagacactt cacatactgc tggtttaaca atgcatgcat caattcttgc atatatgttt aatttggttg aagaaggaaa aataagtaca tcattaaatc ctggaaatcc agttaacaac caaatctttc ttcaggaata tgtggctaat ctccttaagt cggccttccc tcacctacaa gatgctcaag taaagctctt tgtgacaggg cttttcagct taaatcaaga tattcctgct ttcaaggaac atttaagaga tttcctagtt caaataaagg aatttgcagg tgaagacact tctgatttgt ttttggaaga gagagaaata gccctacggc aggctgatga agagaaacat aaacgtcaaa tgtctgtccc tggcatcttt aatccacatg agattccaga agaaatgtgt gattaa. It is sometimes possible for the material contained within the vial of "XPO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.