Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XPNPEP3 cdna clone

XPNPEP3 cDNA Clone

Gene Names
XPNPEP3; APP3; ICP55; NPHPL1
Synonyms
XPNPEP3; XPNPEP3 cDNA Clone; XPNPEP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgccttggctgctctcagcccccaagctggttcccgctgtagcaaacgtccgcggcctctcaggatgtatgttgtgttcacagcgaaggtactcccttcagcctgtcccagaaaggaggattccaaaccgatacttaggccagcccagcccctttacacacccacacctcctcagaccaggggaggtaactccaggactatctcaggtggaatatgcacttcgcagacacaaactaatgtctctgatccagaaggaagctcaagggcagagtgggacagaccagacagtggttgtgctctccaaccctacatactacatgagcaacgatattccctatactttccaccaagacaacaatttcctgtacctatgtggattccaagagcctgatagcattcttgtccttcagagcctccctggcaaacaattaccatcacacaaagccatactttttgtgcctcggcgagatcccagtcgagaactttgggatggtccgcgatctggcactgatggagcaatagctctaactggagtagacgaagcctatacgctagaagaatttcaacatcttctaccaaaaatgaaagctgagacgaacatggtttggtatgactggatgaggccctcacatgcacagcttcactctgactatatgcagcccctgactgaggccaaagccaagagcaagaacaaggttcggggtgttcagcagctgatacagcgcctccggctgatcaagtctcctgcagaaattgaacgaatgcagattgctgggaagctgacatcacaggctttcatagaaaccatgttcaccagtaaagcccctgtggaagaagcctttctttatgctaagtttgaatttgaatgccgggctcgtggcgcagacattttagcctatccacctgtggtggctggtggtaatcggtcaaacactttgcactatgtgaaaaataatcaactcatcaaggatggggaaatggtgcttctggatggaggttgtgagtcttcctgctatgtgagtgacatcacacgtacgtggccagtcaatggcaggttcaccgcacctcaggcagaactctatgaagccgttctagagatccaaagagattgtttggccctctgcttccctgggacaagcttggagaacatctacagcatgatgctgaccctgataggacagaagcttaaagacttggggatcatgaagaacattaaggaaaataatgccttcaaggctgctcgaaaatactgtcctcatcatgttggccactacctcgggatggatgtccatgacactccagacatgccccgttccctccctctgcagcctgggatggtaatcacaattgagcccggcatttatattccagaggatgacaaagatgccccagagaagtttcggggtcttggtgtacgaattgaggatgatgtagtggtgactcaggactcacctttcatcctttctgcagactgtcccaaagagatgaatgacattgaacagatatgcagccaggcttcttga
Sequence Length
1524
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,712 Da
NCBI Official Full Name
Homo sapiens X-prolyl aminopeptidase (aminopeptidase P) 3, putative, mRNA
NCBI Official Synonym Full Names
X-prolyl aminopeptidase 3
NCBI Official Symbol
XPNPEP3
NCBI Official Synonym Symbols
APP3; ICP55; NPHPL1
NCBI Protein Information
probable Xaa-Pro aminopeptidase 3
UniProt Protein Name
Probable Xaa-Pro aminopeptidase 3
UniProt Gene Name
XPNPEP3
UniProt Synonym Gene Names
X-Pro aminopeptidase 3; APP3
UniProt Entry Name
XPP3_HUMAN

NCBI Description

The protein encoded by this gene belongs to the family of X-pro-aminopeptidases that utilize a metal cofactor, and remove the N-terminal amino acid from peptides with a proline residue in the penultimate position. This protein has been shown to localize to the mitochondria of renal cells, and have a role in ciliary function. Mutations in this gene are associated with nephronophthisis-like nephropathy-1. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene, however, expression of some of these isoforms in vivo is not known.[provided by RefSeq, Mar 2011]

Uniprot Description

XPNPEP3: Defects in XPNPEP3 are the cause of nephronophthisis-like nephropathy type 1 (NPHPL1). A disorder with features of nephronophthisis, a cystic kidney disease leading to end-stage renal failure. Nephronophthisis is histologically characterized by modifications of the tubules with thickening of the basement membrane, interstitial fibrosis and, in the advanced stages, medullary cysts. Typical clinical manifestation are chronic renal failure, anemia, polyuria, polydipsia, isosthenuria, and growth retardation. Associations with extrarenal symptoms are frequent. In NPHPL1 patients, extrarenal symptoms include hypertension, essential tremor, sensorineural hearing loss and gout. Severely affected individuals can manifest a mitochondrial disorder with isolated complex I deficiency activity in muscle, seizures, mental retardation and hypertrophic dilated cardiomyopathy. Belongs to the peptidase M24B family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.4.11.9; Protease

Chromosomal Location of Human Ortholog: 22q13.2

Cellular Component: mitochondrion

Molecular Function: aminopeptidase activity

Biological Process: glomerular filtration; protein processing

Disease: Nephronophthisis-like Nephropathy 1

Research Articles on XPNPEP3

Similar Products

Product Notes

The XPNPEP3 xpnpep3 (Catalog #AAA1268490) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccttggc tgctctcagc ccccaagctg gttcccgctg tagcaaacgt ccgcggcctc tcaggatgta tgttgtgttc acagcgaagg tactcccttc agcctgtccc agaaaggagg attccaaacc gatacttagg ccagcccagc ccctttacac acccacacct cctcagacca ggggaggtaa ctccaggact atctcaggtg gaatatgcac ttcgcagaca caaactaatg tctctgatcc agaaggaagc tcaagggcag agtgggacag accagacagt ggttgtgctc tccaacccta catactacat gagcaacgat attccctata ctttccacca agacaacaat ttcctgtacc tatgtggatt ccaagagcct gatagcattc ttgtccttca gagcctccct ggcaaacaat taccatcaca caaagccata ctttttgtgc ctcggcgaga tcccagtcga gaactttggg atggtccgcg atctggcact gatggagcaa tagctctaac tggagtagac gaagcctata cgctagaaga atttcaacat cttctaccaa aaatgaaagc tgagacgaac atggtttggt atgactggat gaggccctca catgcacagc ttcactctga ctatatgcag cccctgactg aggccaaagc caagagcaag aacaaggttc ggggtgttca gcagctgata cagcgcctcc ggctgatcaa gtctcctgca gaaattgaac gaatgcagat tgctgggaag ctgacatcac aggctttcat agaaaccatg ttcaccagta aagcccctgt ggaagaagcc tttctttatg ctaagtttga atttgaatgc cgggctcgtg gcgcagacat tttagcctat ccacctgtgg tggctggtgg taatcggtca aacactttgc actatgtgaa aaataatcaa ctcatcaagg atggggaaat ggtgcttctg gatggaggtt gtgagtcttc ctgctatgtg agtgacatca cacgtacgtg gccagtcaat ggcaggttca ccgcacctca ggcagaactc tatgaagccg ttctagagat ccaaagagat tgtttggccc tctgcttccc tgggacaagc ttggagaaca tctacagcat gatgctgacc ctgataggac agaagcttaa agacttgggg atcatgaaga acattaagga aaataatgcc ttcaaggctg ctcgaaaata ctgtcctcat catgttggcc actacctcgg gatggatgtc catgacactc cagacatgcc ccgttccctc cctctgcagc ctgggatggt aatcacaatt gagcccggca tttatattcc agaggatgac aaagatgccc cagagaagtt tcggggtctt ggtgtacgaa ttgaggatga tgtagtggtg actcaggact cacctttcat cctttctgca gactgtccca aagagatgaa tgacattgaa cagatatgca gccaggcttc ttga. It is sometimes possible for the material contained within the vial of "XPNPEP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.