Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR33 cdna clone

WDR33 cDNA Clone

Gene Names
WDR33; NET14; WDC146
Synonyms
WDR33; WDR33 cDNA Clone; WDR33 cdna clone
Ordering
For Research Use Only!
Sequence
atggctacagaaattggttctcctcctcgttttttccatatgccaaggttccagcaccaggcacctcgacagctgttttataagcgacctgattttgcacaacagcaagcaatgcaacagcttacttttgatggaaaacgaatgagaaaagctgtgaaccgaaaaaccatagactacaatccatctgtaattaagtatttggagaacagaatatggcaaagagaccagagagatatgcgggcaattcagcctgatgcaggttattacaatgatctggtcccacctataggaatgttgaataatcctatgaatgcagtaacaacaaaatttgttcggacatcaacaaataaagtaaagtgtcctgtatttgttgttaggtggactccagaaggaagacgcttggtcactggagcttctagtggggagtttaccctgtggaatggactcactttcaattttgaaacaatattacaggctcacgacagcccagtgagggccatgacgtggtcacataatgacatgtggatgttgacagcagaccacggaggatatgtgaaatattggcagtcgaacatgaacaacgtcaagatgttccaggcacataaggaggcgattagagaggccaggtttatacacaatataccattttctgtagtccctattgtcatggttaaattattctctaagtgtattctgggtgcagagatgcatgggctctgtcagtttctgggaaactttctgcaccctataaacacaatatttttctttgttttcacacattcaccattttgctggcacctttctgaagtagtgttgtcccggtatcagcctttgcaatatgttagagatgtactgtctgccgcattttgcactggttttctcttttcatttatgattaataatgtgtatacgttattcctttttattatctactgtgtaagacaagaatatttcattccaaataaagaattcagtctttaa
Sequence Length
981
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,288 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 33, mRNA
NCBI Official Synonym Full Names
WD repeat domain 33
NCBI Official Symbol
WDR33
NCBI Official Synonym Symbols
NET14; WDC146
NCBI Protein Information
pre-mRNA 3' end processing protein WDR33
UniProt Protein Name
pre-mRNA 3' end processing protein WDR33
UniProt Gene Name
WDR33
UniProt Synonym Gene Names
WDC146
UniProt Entry Name
WDR33_HUMAN

NCBI Description

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

WDR33: a nuclear WD40 repeat protein. WD40 repeats are found in a number of eukaryotic proteins that coordinate multi-protein complex assemblies. WD40 proteins are implicated in many functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 2q14.3

Cellular Component: mRNA cleavage and polyadenylation specificity factor complex; nucleolus; nucleus

Biological Process: mRNA cleavage

Research Articles on WDR33

Similar Products

Product Notes

The WDR33 wdr33 (Catalog #AAA1269354) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctacag aaattggttc tcctcctcgt tttttccata tgccaaggtt ccagcaccag gcacctcgac agctgtttta taagcgacct gattttgcac aacagcaagc aatgcaacag cttacttttg atggaaaacg aatgagaaaa gctgtgaacc gaaaaaccat agactacaat ccatctgtaa ttaagtattt ggagaacaga atatggcaaa gagaccagag agatatgcgg gcaattcagc ctgatgcagg ttattacaat gatctggtcc cacctatagg aatgttgaat aatcctatga atgcagtaac aacaaaattt gttcggacat caacaaataa agtaaagtgt cctgtatttg ttgttaggtg gactccagaa ggaagacgct tggtcactgg agcttctagt ggggagttta ccctgtggaa tggactcact ttcaattttg aaacaatatt acaggctcac gacagcccag tgagggccat gacgtggtca cataatgaca tgtggatgtt gacagcagac cacggaggat atgtgaaata ttggcagtcg aacatgaaca acgtcaagat gttccaggca cataaggagg cgattagaga ggccaggttt atacacaata taccattttc tgtagtccct attgtcatgg ttaaattatt ctctaagtgt attctgggtg cagagatgca tgggctctgt cagtttctgg gaaactttct gcaccctata aacacaatat ttttctttgt tttcacacat tcaccatttt gctggcacct ttctgaagta gtgttgtccc ggtatcagcc tttgcaatat gttagagatg tactgtctgc cgcattttgc actggttttc tcttttcatt tatgattaat aatgtgtata cgttattcct ttttattatc tactgtgtaa gacaagaata tttcattcca aataaagaat tcagtcttta a. It is sometimes possible for the material contained within the vial of "WDR33, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.