Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WARS cdna clone

WARS cDNA Clone

Gene Names
WARS; IFI53; IFP53; GAMMA-2
Synonyms
WARS; WARS cDNA Clone; WARS cdna clone
Ordering
For Research Use Only!
Sequence
atgcccaacagtgagcccgcatctctgctggagctgttcaacagcatcgccacacaaggggagctcgtaaggtccctcaaagcgggaaatgcgtcaaaggatgaaattgattctgcagtaaagatgttggtgtcattaaaaatgagctacaaagctgccgcgggggaggattacaaggctgactgtcctccagggaacccagcacctaccagtaatcatggcccagatgccacagaagctgaagaggattttgtggacccatggacagtacagacaagcagtgcaaaaggcatagactacgataagctcattgttcggtttggaagtagtaaaattgacaaagagctaataaaccgaatagagagagccaccggccaaagaccacaccacttcctgcgcagaggcatcttcttctcacacagagatatgaatcaggttcttgatgcctatgaaaataagaagccattttatctgtacacgggccggggcccctcttctgaagcaatgcatgtaggtcacctcattccatttattttcacaaagtggctccaggatgtatttaacgtgcccttggtcatccagatgacggatgacgagaagtatctgtggaaggacctgaccctggaccaggcctatagctatgctgtggagaatgccaaggacatcatcgcctgtggctttgacatcaacaagactttcatattctctgacctggactacatggggatgagctcaggtttctacaaaaatgtggtgaagattcaaaagcatgttaccttcaaccaagtgaaaggcattttcggcttcactgacagcgactgcattgggaagatcagttttcctgccatccaggctgctccctccttcagcaactcattcccacagatcttccgagacaggacggatatccagtgccttatcccatgtgccattgaccaggatccttactttagaatgacaagggacgtcgcccccaggatcggctatcctaaaccagccctgctgcactccaccttcttcccagccctgcagggcgcccagaccaaaatgagtgccagcgaccccaactcctccatcttcctcaccgacacggccaagcagatcaaaaccaaggtcaataagcatgcgttttctggagggagagacaccatcgaggagcacaggcagtttgggggcaactgtgatgtggacgtgtctttcatgtacctgaccttcttcctcgaggacgacgacaagctcgagcagatcaggaaggattacaccagcggagccatgctcaccggtgagctcaagaaggcactcatagaggttctgcagcccttgatcgcagagcaccaggcccggcgcaaggaggtcacggatgagatagtgaaagagttcatgactccccggaagctgtccttcgactttcagtag
Sequence Length
1416
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,852 Da
NCBI Official Full Name
Homo sapiens tryptophanyl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
tryptophanyl-tRNA synthetase
NCBI Official Symbol
WARS
NCBI Official Synonym Symbols
IFI53; IFP53; GAMMA-2
NCBI Protein Information
tryptophan--tRNA ligase, cytoplasmic
UniProt Protein Name
Tryptophan--tRNA ligase, cytoplasmic
Protein Family
UniProt Gene Name
WARS
UniProt Synonym Gene Names
IFI53; WRS; IFP53; TrpRS; hWRS
UniProt Entry Name
SYWC_HUMAN

NCBI Description

Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Two forms of tryptophanyl-tRNA synthetase exist, a cytoplasmic form, named WARS, and a mitochondrial form, named WARS2. Tryptophanyl-tRNA synthetase (WARS) catalyzes the aminoacylation of tRNA(trp) with tryptophan and is induced by interferon. Tryptophanyl-tRNA synthetase belongs to the class I tRNA synthetase family. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

WARS: Isoform 1, isoform 2 and T1-TrpRS have aminoacylation activity while T2-TrpRS lacks it. Isoform 2, T1-TrpRS and T2-TrpRS possess angiostatic activity whereas isoform 1 lacks it. T2-TrpRS inhibits fluid shear stress-activated responses of endothelial cells. Regulates ERK, Akt, and eNOS activation pathways that are associated with angiogenesis, cytoskeletal reorganization and shear stress-responsive gene expression. Belongs to the class-I aminoacyl-tRNA synthetase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Translation; Amino Acid Metabolism - tryptophan; EC 6.1.1.2

Chromosomal Location of Human Ortholog: 14q32.31

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: protein binding; tryptophan-tRNA ligase activity

Biological Process: negative regulation of cell proliferation; regulation of angiogenesis; translation; tRNA aminoacylation for protein translation

Research Articles on WARS

Similar Products

Product Notes

The WARS wars (Catalog #AAA1266570) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccaaca gtgagcccgc atctctgctg gagctgttca acagcatcgc cacacaaggg gagctcgtaa ggtccctcaa agcgggaaat gcgtcaaagg atgaaattga ttctgcagta aagatgttgg tgtcattaaa aatgagctac aaagctgccg cgggggagga ttacaaggct gactgtcctc cagggaaccc agcacctacc agtaatcatg gcccagatgc cacagaagct gaagaggatt ttgtggaccc atggacagta cagacaagca gtgcaaaagg catagactac gataagctca ttgttcggtt tggaagtagt aaaattgaca aagagctaat aaaccgaata gagagagcca ccggccaaag accacaccac ttcctgcgca gaggcatctt cttctcacac agagatatga atcaggttct tgatgcctat gaaaataaga agccatttta tctgtacacg ggccggggcc cctcttctga agcaatgcat gtaggtcacc tcattccatt tattttcaca aagtggctcc aggatgtatt taacgtgccc ttggtcatcc agatgacgga tgacgagaag tatctgtgga aggacctgac cctggaccag gcctatagct atgctgtgga gaatgccaag gacatcatcg cctgtggctt tgacatcaac aagactttca tattctctga cctggactac atggggatga gctcaggttt ctacaaaaat gtggtgaaga ttcaaaagca tgttaccttc aaccaagtga aaggcatttt cggcttcact gacagcgact gcattgggaa gatcagtttt cctgccatcc aggctgctcc ctccttcagc aactcattcc cacagatctt ccgagacagg acggatatcc agtgccttat cccatgtgcc attgaccagg atccttactt tagaatgaca agggacgtcg cccccaggat cggctatcct aaaccagccc tgctgcactc caccttcttc ccagccctgc agggcgccca gaccaaaatg agtgccagcg accccaactc ctccatcttc ctcaccgaca cggccaagca gatcaaaacc aaggtcaata agcatgcgtt ttctggaggg agagacacca tcgaggagca caggcagttt gggggcaact gtgatgtgga cgtgtctttc atgtacctga ccttcttcct cgaggacgac gacaagctcg agcagatcag gaaggattac accagcggag ccatgctcac cggtgagctc aagaaggcac tcatagaggt tctgcagccc ttgatcgcag agcaccaggc ccggcgcaag gaggtcacgg atgagatagt gaaagagttc atgactcccc ggaagctgtc cttcgacttt cagtag. It is sometimes possible for the material contained within the vial of "WARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.