Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VTI1A cdna clone

VTI1A cDNA Clone

Gene Names
VTI1A; MMDS3; MVti1; VTI1RP2; Vti1-rp2
Synonyms
VTI1A; VTI1A cDNA Clone; VTI1A cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtccgacttcgaaggttacgagcaggacttcgcggtgctcactgcagagatcaccagcaagattgcgagggtcccacgactcccgcctgatgaaaagaaacagatggttgcaaatgtggagaaacagcttgaagaagcgaaagaactgcttgaacagatggatttggaagtccgagagataccaccccaaagtcgagggatgtacagcaacagaatgagaagctacaaacaagaaatgggaaaactcgaaacagattttaaaaggtcacggatcgcctacagtgacgaagtacggaatgagctcctgggggatgatgggaattcctcagagaaccagagggcacatctgctcgataacacagagaggctggaaaggtcatctcggagactagaggctggataccaaatagcagtggaaaccgagcaaattggtcaggagatgttggaaaaccttagtcatgacagagaaaagatacagcgagcacgtgaaagacttcgggaaacagatgctaatttgggaaaaagctccaggattctgacagggatgttgcgaaggggttgttctgtgaaaaaacaatgtaacctgtctctggccccaaaggcttga
Sequence Length
612
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,435 Da
NCBI Official Full Name
Homo sapiens vesicle transport through interaction with t-SNAREs homolog 1A (yeast), mRNA
NCBI Official Synonym Full Names
vesicle transport through interaction with t-SNAREs 1A
NCBI Official Symbol
VTI1A
NCBI Official Synonym Symbols
MMDS3; MVti1; VTI1RP2; Vti1-rp2
NCBI Protein Information
vesicle transport through interaction with t-SNAREs homolog 1A
UniProt Protein Name
Vesicle transport through interaction with t-SNAREs homolog 1A
UniProt Gene Name
VTI1A
UniProt Entry Name
VTI1A_HUMAN

NCBI Description

The protein encoded by this gene is a member of the family of soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptors (SNAREs) that function in intracellular trafficking. This family member is involved in vesicular transport between endosomes and the trans-Golgi network. It is a vesicle-associated SNARE (v-SNARE) that interacts with target membrane SNAREs (t-SNAREs). Polymorphisms in this gene have been associated with binocular function, and also with susceptibility to colorectal and lung cancers. A recurrent rearrangement has been found between this gene and the transcription factor 7-like 2 (TCF7L2) gene in colorectal cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Uniprot Description

VTI1A: V-SNARE that mediates vesicle transport pathways through interactions with t-SNAREs on the target membrane. These interactions are proposed to mediate aspects of the specificity of vesicle trafficking and to promote fusion of the lipid bilayers. Involved in vesicular transport from the late endosomes to the trans-Golgi network. Along with VAMP7, involved in an non- conventional RAB1-dependent traffic route to the cell surface used by KCNIP1 and KCND2. May be involved in increased cytokine secretion associated with cellular senescence. Belongs to the VTI1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 10q25.2

Cellular Component: autophagic vacuole; cell soma; clathrin-coated vesicle; endoplasmic reticulum membrane; endosome; Golgi apparatus; Golgi membrane; late endosome membrane; perinuclear region of cytoplasm; SNARE complex; synaptic vesicle; trans-Golgi network membrane

Molecular Function: protein binding; SNAP receptor activity; SNARE binding

Biological Process: autophagy; ER to Golgi vesicle-mediated transport; Golgi to vacuole transport; intra-Golgi vesicle-mediated transport; protein targeting to vacuole; retrograde transport, endosome to Golgi; vesicle fusion with Golgi apparatus; voluntary musculoskeletal movement

Disease: Multiple Mitochondrial Dysfunctions Syndrome 3

Research Articles on VTI1A

Similar Products

Product Notes

The VTI1A vti1a (Catalog #AAA1269177) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtccg acttcgaagg ttacgagcag gacttcgcgg tgctcactgc agagatcacc agcaagattg cgagggtccc acgactcccg cctgatgaaa agaaacagat ggttgcaaat gtggagaaac agcttgaaga agcgaaagaa ctgcttgaac agatggattt ggaagtccga gagataccac cccaaagtcg agggatgtac agcaacagaa tgagaagcta caaacaagaa atgggaaaac tcgaaacaga ttttaaaagg tcacggatcg cctacagtga cgaagtacgg aatgagctcc tgggggatga tgggaattcc tcagagaacc agagggcaca tctgctcgat aacacagaga ggctggaaag gtcatctcgg agactagagg ctggatacca aatagcagtg gaaaccgagc aaattggtca ggagatgttg gaaaacctta gtcatgacag agaaaagata cagcgagcac gtgaaagact tcgggaaaca gatgctaatt tgggaaaaag ctccaggatt ctgacaggga tgttgcgaag gggttgttct gtgaaaaaac aatgtaacct gtctctggcc ccaaaggctt ga. It is sometimes possible for the material contained within the vial of "VTI1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.