VPS41 cdna clone
VPS41 cDNA Clone
Gene Names
VPS41; HVPS41; HVSP41; hVps41p
Synonyms
VPS41; VPS41 cDNA Clone; VPS41 cdna clone
Sequence
atggcggaagcagaggagcaggaaactgggtcccttgaagaatctacagatgagtctgaggaagaagagagcgaagaggaacccaagctgaagtatgaaaggctttccaatggggtaactgaaatacttcagaaggatgcagctagctgcatgacagtccatgacaagtttttggcattgggcacacattatggcaaggtttatttacttgatgtccaggggaacatcactcagaagtttgatgtaagtcctgtgaagataaatcagattagcttggatgaaagtggagagcacatgggtgtgtgttcagaggatggcaaggtgcaggtatttggactgtattctggagaagaatttcacgagacttttgactgtcccattaaaattattgctgtgcacccacatttcgtgagatccagttgcaagcagtttgtgaccggagggaagaagctgctactgtttgaacggtcttggatgaacagatggaagtctgctgttctgcatgaaggggaagggaacataaggagtgtgaagtggagaggccatctgattgcttgggccaataatatgggtgtgaagatttttgacatcatctcaaagcaaagaatcaccaatgtgccccgggatgatataagtcttcgcccagacatgtatccctgcagcctctgctggaaggacaatgtgacactgattattggctgggggacttctgtcaaggtgtgctcagtgaaggaacggcatgccagtgaaatgagggatttgccaagtcgatatgttgaaatagtgtctcagtttgaaactgaattctacatcagtggacttgcacctctctgtgatcagcttgttgtactttcgtatgtaaaggagatttcagaaaaaacggaaagagaatactgtgccaggcctagactggacatcatccagccactttctgagacttgtgaagagatctcttctgatgctttgacagtcagaggctttcaggagaatgaatgtagagattatcatttagaatactctgaaggggaatcacttttttacatcgtgagtccgagagatgttgtagtggccaaggaacgagaccaagatgatcacattgactggctccttgaaaagaagaaatatgaagaagcattgatggcagctgaaattagccaaaaaaatattaaaagacataagattctggatattggcttggcatatataaatcacctggtggagagaggagactatgacatagcagcacgcaaatgccagaaaattcttgggaaaaatgcagcactctgggaatatgaagtttataaatttaaagaaattggacagcttaaggctattagtccttatttgccaagaggtgatccagttctgaaaccactcatctatgaaatgatcttacatgaatttttggagagtgattatgagggttttgccacattgatccgagaatggcctggagatctgtataataattcagtcatagttcaagcagttcgggatcatttgaagaaagatagtcagaacaagactttacttaaaaccctggcagaattgtacacctatgacaagaactatggcaatgctctggaaatatacttaacattaagacataaagacgtttttcagttgatccacaagcataatcttttcagttctatcaaggataaaattgttttattaatggattttgattcagagaaagctgttgacatgcttttggacaatgaagataaaatttcaattaaaaaggtagtggaagaattggaagacagaccagagctacagcatgtgtatttgcataagcttttcaagagagaccaccataaggggcagcgttaccatgaaaaacagatcagtctttatgctgaatatgatcgaccaaacttacttccctttctccgagacagtacccattgcccacttgaaaaggctcttgagatctgtcaacagagaaactttgtagaagagacagtttatcttctgagccgaatgggtaatagccgaagtgccctgaagatgattatggaggaattacatgatgttgataaagcaatcgaatttgccaaggagcaagatgatggagagctgtgggaagatttgattttatattccattgacaaaccaccatttattactggcttgttaaacaacattggcacacatgttgacccaattctactgattcaccgtattaaggaaggaatggagatccccaatttgagagattccttggttaaaattctgcaagactacaatttgcaaattctgcttcgtgaaggctgcaagaagattctcgtagctgactctttgtccttactgaagaaaatgcaccgaactcaaatgaaaggtgttcttgttgatgaggagaacatctgtgagtcgtgcctttcccctattcttccatcagatgcagctaagcccttcagcgtggtggtcttccattgccggcacatgttccacaaggagtgcctgcccatgcccagcatgaactctgctgcacagttctgcaacatctgcagtgctaagaaccgtggaccaggaagtgcaattttggagatgaaaaaatag
Sequence Length
2565
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
95,924 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 41 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS41, HOPS complex subunit
NCBI Official Symbol
VPS41
NCBI Official Synonym Symbols
HVPS41; HVSP41; hVps41p
NCBI Protein Information
vacuolar protein sorting-associated protein 41 homolog
UniProt Protein Name
Vacuolar protein sorting-associated protein 41 homolog
Protein Family
UniProt Gene Name
VPS41
UniProt Entry Name
VPS41_HUMAN
NCBI Description
Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]
Uniprot Description
VPS41: Required for vacuolar assembly and vacuolar traffic. Belongs to the VPS41 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ubiquitin conjugating system; Vesicle
Chromosomal Location of Human Ortholog: 7p14-p13
Cellular Component: clathrin-coated vesicle; endosome membrane; late endosome membrane; lysosomal membrane
Molecular Function: GTPase binding; identical protein binding; protein binding
Biological Process: endosomal vesicle fusion; endosome to lysosome transport; protein targeting to vacuole; vacuole fusion, non-autophagic
Research Articles on VPS41
Similar Products
Product Notes
The VPS41 vps41 (Catalog #AAA1268737) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggaag cagaggagca ggaaactggg tcccttgaag aatctacaga tgagtctgag gaagaagaga gcgaagagga acccaagctg aagtatgaaa ggctttccaa tggggtaact gaaatacttc agaaggatgc agctagctgc atgacagtcc atgacaagtt tttggcattg ggcacacatt atggcaaggt ttatttactt gatgtccagg ggaacatcac tcagaagttt gatgtaagtc ctgtgaagat aaatcagatt agcttggatg aaagtggaga gcacatgggt gtgtgttcag aggatggcaa ggtgcaggta tttggactgt attctggaga agaatttcac gagacttttg actgtcccat taaaattatt gctgtgcacc cacatttcgt gagatccagt tgcaagcagt ttgtgaccgg agggaagaag ctgctactgt ttgaacggtc ttggatgaac agatggaagt ctgctgttct gcatgaaggg gaagggaaca taaggagtgt gaagtggaga ggccatctga ttgcttgggc caataatatg ggtgtgaaga tttttgacat catctcaaag caaagaatca ccaatgtgcc ccgggatgat ataagtcttc gcccagacat gtatccctgc agcctctgct ggaaggacaa tgtgacactg attattggct gggggacttc tgtcaaggtg tgctcagtga aggaacggca tgccagtgaa atgagggatt tgccaagtcg atatgttgaa atagtgtctc agtttgaaac tgaattctac atcagtggac ttgcacctct ctgtgatcag cttgttgtac tttcgtatgt aaaggagatt tcagaaaaaa cggaaagaga atactgtgcc aggcctagac tggacatcat ccagccactt tctgagactt gtgaagagat ctcttctgat gctttgacag tcagaggctt tcaggagaat gaatgtagag attatcattt agaatactct gaaggggaat cactttttta catcgtgagt ccgagagatg ttgtagtggc caaggaacga gaccaagatg atcacattga ctggctcctt gaaaagaaga aatatgaaga agcattgatg gcagctgaaa ttagccaaaa aaatattaaa agacataaga ttctggatat tggcttggca tatataaatc acctggtgga gagaggagac tatgacatag cagcacgcaa atgccagaaa attcttggga aaaatgcagc actctgggaa tatgaagttt ataaatttaa agaaattgga cagcttaagg ctattagtcc ttatttgcca agaggtgatc cagttctgaa accactcatc tatgaaatga tcttacatga atttttggag agtgattatg agggttttgc cacattgatc cgagaatggc ctggagatct gtataataat tcagtcatag ttcaagcagt tcgggatcat ttgaagaaag atagtcagaa caagacttta cttaaaaccc tggcagaatt gtacacctat gacaagaact atggcaatgc tctggaaata tacttaacat taagacataa agacgttttt cagttgatcc acaagcataa tcttttcagt tctatcaagg ataaaattgt tttattaatg gattttgatt cagagaaagc tgttgacatg cttttggaca atgaagataa aatttcaatt aaaaaggtag tggaagaatt ggaagacaga ccagagctac agcatgtgta tttgcataag cttttcaaga gagaccacca taaggggcag cgttaccatg aaaaacagat cagtctttat gctgaatatg atcgaccaaa cttacttccc tttctccgag acagtaccca ttgcccactt gaaaaggctc ttgagatctg tcaacagaga aactttgtag aagagacagt ttatcttctg agccgaatgg gtaatagccg aagtgccctg aagatgatta tggaggaatt acatgatgtt gataaagcaa tcgaatttgc caaggagcaa gatgatggag agctgtggga agatttgatt ttatattcca ttgacaaacc accatttatt actggcttgt taaacaacat tggcacacat gttgacccaa ttctactgat tcaccgtatt aaggaaggaa tggagatccc caatttgaga gattccttgg ttaaaattct gcaagactac aatttgcaaa ttctgcttcg tgaaggctgc aagaagattc tcgtagctga ctctttgtcc ttactgaaga aaatgcaccg aactcaaatg aaaggtgttc ttgttgatga ggagaacatc tgtgagtcgt gcctttcccc tattcttcca tcagatgcag ctaagccctt cagcgtggtg gtcttccatt gccggcacat gttccacaag gagtgcctgc ccatgcccag catgaactct gctgcacagt tctgcaacat ctgcagtgct aagaaccgtg gaccaggaag tgcaattttg gagatgaaaa aatag. It is sometimes possible for the material contained within the vial of "VPS41, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
