Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS39 cdna clone

VPS39 cDNA Clone

Gene Names
VPS39; TLP; VAM6; hVam6p
Synonyms
VPS39; VPS39 cDNA Clone; VPS39 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacgacgctttcgagccagtgccgatcctagaaaagctgcctctgcaaatcgactgtctggctgcctgggaggaatggcttcttgtgggaaccaaacaaggacatcttcttctctataggattcggaaggacgttggttgcaacagatttgaagtgacactagagaaatccaataagaacttctccaaaaagattcagcagatccatgtggtttcccagtttaagattctggtcagcttgttagaaaataacatttatgtccatgacctattgacatttcaacaaatcactacggtttcaaaggcaaagggagcatcactgtttacttgtgacctccagcacacagagaccggtgaggaggtgttacggatgtgtgtggcagtaaaaaagaagctgcagctctatttctggaaggacagggaatttcatgaattgcagggggactttagtgtgccagatgtgcccaagtccatggcgtggtgtgaaaattctatctgtgtgggtttcaagagagactactacctaataagggtggatggaaaggggtccatcaaagagctctttccaacaggaaaacagctggagcccttagttgcacctctggcagatggaaaagtggctgtgggccaggatgatctcaccgtggtactcaatgaggaagggatctgcacacagaaatgtgccctgaactggacggacataccagtggccatggagcaccagcctccctacatcattgcagtgttgcctcgatatgttgagatccgaacatttgaaccgaggcttctggtccaaagcattgaattgcaaaggccccgtttcattacctcaggaggatcaaacattatctatgtggccagcaatcattttgtttggagactcatccctgtccccatggcaacccaaatccaacaacttctccaggacaagcagtttgaattggctctgcagctcgcagaaatgaaagatgattctgacagtgaaaagcagcaacaaattcatcacatcaagaacttgtatgccttcaacctcttctgccagaagcgttttgatgagtccatgcaggtctttgctaaacttggcacagatcccacccatgtgatgggcctgtaccctgacctgctgcccacagactacagaaagcagttgcagtatcccaacccattgcctgtgctctccggggctgaattggagaaggctcacttagctctgattgactacctgacacagaaacgaagtcaattggtaaagaagctgaatgactctgatcaccagtcaagcacctcaccgctcatggaaggcactcccaccatcaaatccaagaagaagctgctacaaatcatcgacaccaccctgctcaagtgctatctccatacaaatgtggccctggtggcccccttgctacgcctggagaacaatcactgccacatcgaggagagcgagcacgtgctaaagaaggctcacaagtacagtgagcttatcatcctgtatgagaagaaggggctccacgagaaagctctgcaggtgctcgtggaccagtccaagaaagccaactcccctctgaaaggccacgagaggacagtgcagtatctgcagcatctgggcacagaaaacctgcatttgattttctcctactcagtgtgggtgctgagagacttcccagaagatggcctgaagatatttactgaagatctcccggaagtggagtctctgccacgtgatcgagtcctcggcttcttaatagagaattttaagggtctggctattccttatctggaacacatcatccatgtttgggaggagacaggctctcggttccacaactgcctgatccagctatactgtgagaaggtgcaaggtctgatgaaggagtatctcctgtccttccctgcaggcaaaaccccagtcccagctggagaggaagagggtgagctgggagaataccggcaaaagctcctcatgttcttggagatttccagctactatgatccaggccggctcatctgtgattttccctttgatggcctcttagaagaacgagctctcctgttggggcgcatggggaaacatgaacaagctcttttcatttatgtccacatcttgaaggatacaaggatggctgaggagtactgccacaaacactatgaccgaaacaaagatggcaacaaagatgtgtatctgtccctgcttcggatgtacctgtcgccccccagcattcactgcctggggccaatcaagctggaactactggagccaaaagccaacctccaggccgctctgcaggtcctcgagctacaccacagcaaactggacaccaccaaggccctcaaccttctgccagcaaacactcagatcaatgacatacgcatcttcctggaaaaggtcttggaagaaaatgcacaaaagaaacggttcaatcaagtgctcaagaaccttctccatgcagaattcctgagggtccaggaagagcggattttacaccagcaggtgaagtgcatcatcacagaggagaaggtgtgcatggtgtgtaagaagaagattgggaacagtgcatttgcaagataccccaatggagtggtcgtccattacttctgttccaaagaggtaaacccagctgacacttga
Sequence Length
2628
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
100,769 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 39 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS39, HOPS complex subunit
NCBI Official Symbol
VPS39
NCBI Official Synonym Symbols
TLP; VAM6; hVam6p
UniProt Protein Name
Vam6/Vps39-like protein
Protein Family
UniProt Gene Name
VPS39
UniProt Synonym Gene Names
KIAA0770; TLP; VAM6; hVam6p
UniProt Entry Name
VPS39_HUMAN

NCBI Description

This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

VPS39: May play a role in clustering and fusion of late endosomes and lysosomes. Regulator of TGF-beta/activin signaling, inhibiting SMAD3- and activating SMAD2-dependent transcription. Acts by interfering with SMAD3/SMAD4 complex formation, this would lead to inhibition of SMAD3-dependent transcription and relieve SMAD3 inhibition of SMAD2-dependent promoters, thus increasing SMAD2-dependent transcription. Does not affect TGF-beta-induced SMAD2 or SMAD3 phosphorylation, nor SMAD2/SMAD4 complex formation. Belongs to the VAM6/VPS39 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein regulator, misc.; Membrane protein, peripheral

Chromosomal Location of Human Ortholog: 15q15.1

Cellular Component: late endosome membrane; lysosomal membrane

Biological Process: autophagy; endosomal vesicle fusion; endosome to lysosome transport

Research Articles on VPS39

Similar Products

Product Notes

The VPS39 vps39 (Catalog #AAA1269276) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacgacg ctttcgagcc agtgccgatc ctagaaaagc tgcctctgca aatcgactgt ctggctgcct gggaggaatg gcttcttgtg ggaaccaaac aaggacatct tcttctctat aggattcgga aggacgttgg ttgcaacaga tttgaagtga cactagagaa atccaataag aacttctcca aaaagattca gcagatccat gtggtttccc agtttaagat tctggtcagc ttgttagaaa ataacattta tgtccatgac ctattgacat ttcaacaaat cactacggtt tcaaaggcaa agggagcatc actgtttact tgtgacctcc agcacacaga gaccggtgag gaggtgttac ggatgtgtgt ggcagtaaaa aagaagctgc agctctattt ctggaaggac agggaatttc atgaattgca gggggacttt agtgtgccag atgtgcccaa gtccatggcg tggtgtgaaa attctatctg tgtgggtttc aagagagact actacctaat aagggtggat ggaaaggggt ccatcaaaga gctctttcca acaggaaaac agctggagcc cttagttgca cctctggcag atggaaaagt ggctgtgggc caggatgatc tcaccgtggt actcaatgag gaagggatct gcacacagaa atgtgccctg aactggacgg acataccagt ggccatggag caccagcctc cctacatcat tgcagtgttg cctcgatatg ttgagatccg aacatttgaa ccgaggcttc tggtccaaag cattgaattg caaaggcccc gtttcattac ctcaggagga tcaaacatta tctatgtggc cagcaatcat tttgtttgga gactcatccc tgtccccatg gcaacccaaa tccaacaact tctccaggac aagcagtttg aattggctct gcagctcgca gaaatgaaag atgattctga cagtgaaaag cagcaacaaa ttcatcacat caagaacttg tatgccttca acctcttctg ccagaagcgt tttgatgagt ccatgcaggt ctttgctaaa cttggcacag atcccaccca tgtgatgggc ctgtaccctg acctgctgcc cacagactac agaaagcagt tgcagtatcc caacccattg cctgtgctct ccggggctga attggagaag gctcacttag ctctgattga ctacctgaca cagaaacgaa gtcaattggt aaagaagctg aatgactctg atcaccagtc aagcacctca ccgctcatgg aaggcactcc caccatcaaa tccaagaaga agctgctaca aatcatcgac accaccctgc tcaagtgcta tctccataca aatgtggccc tggtggcccc cttgctacgc ctggagaaca atcactgcca catcgaggag agcgagcacg tgctaaagaa ggctcacaag tacagtgagc ttatcatcct gtatgagaag aaggggctcc acgagaaagc tctgcaggtg ctcgtggacc agtccaagaa agccaactcc cctctgaaag gccacgagag gacagtgcag tatctgcagc atctgggcac agaaaacctg catttgattt tctcctactc agtgtgggtg ctgagagact tcccagaaga tggcctgaag atatttactg aagatctccc ggaagtggag tctctgccac gtgatcgagt cctcggcttc ttaatagaga attttaaggg tctggctatt ccttatctgg aacacatcat ccatgtttgg gaggagacag gctctcggtt ccacaactgc ctgatccagc tatactgtga gaaggtgcaa ggtctgatga aggagtatct cctgtccttc cctgcaggca aaaccccagt cccagctgga gaggaagagg gtgagctggg agaataccgg caaaagctcc tcatgttctt ggagatttcc agctactatg atccaggccg gctcatctgt gattttccct ttgatggcct cttagaagaa cgagctctcc tgttggggcg catggggaaa catgaacaag ctcttttcat ttatgtccac atcttgaagg atacaaggat ggctgaggag tactgccaca aacactatga ccgaaacaaa gatggcaaca aagatgtgta tctgtccctg cttcggatgt acctgtcgcc ccccagcatt cactgcctgg ggccaatcaa gctggaacta ctggagccaa aagccaacct ccaggccgct ctgcaggtcc tcgagctaca ccacagcaaa ctggacacca ccaaggccct caaccttctg ccagcaaaca ctcagatcaa tgacatacgc atcttcctgg aaaaggtctt ggaagaaaat gcacaaaaga aacggttcaa tcaagtgctc aagaaccttc tccatgcaga attcctgagg gtccaggaag agcggatttt acaccagcag gtgaagtgca tcatcacaga ggagaaggtg tgcatggtgt gtaagaagaa gattgggaac agtgcatttg caagataccc caatggagtg gtcgtccatt acttctgttc caaagaggta aacccagctg acacttga. It is sometimes possible for the material contained within the vial of "VPS39, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.