VMO1 cdna clone
VMO1 cDNA Clone
Gene Names
VMO1; ERGA6350; PRO21055
Synonyms
VMO1; VMO1 cDNA Clone; VMO1 cdna clone
Sequence
ATGGAGCGGGGCGCAGGAGCCAAGCTGCTGCCGCTGCTGCTGCTTCTGCGGGCGACTGGTTTCACATGTGCACAGACAGATGGCCGGAACGGCTACACGGCGGTCATCGAAGTGACCAGCGGGGGTCCCTGGGGCGACTGGGCCTGGCCTGAGATGTGTCCCGATGGATTCTTCGCCAGCGGGTTCTCGCTCAAGGTGGAGCCTCCCCAAGGCATTCCTGGCGACGACACTGCACTGAATGGGATCAGGCTGCACTGCGCGCGCGGGAACGTCCTAGGCAATACGCACGTGGTAGAGTCCCAGTCTGGAAGCTGGGGCGAATGGAGTGAGCCGCTGTGGTGTCGCGGCGGCGCCTACCTAGTGGCTTTCTCGCTTCGCGTGGAGGCACCCACGACCCTCGGTGACAACACAGCAGCGAACAACGTGCGCTTCCGCTGTTCAGACGGCGAGGAACTGCAGGGGCCTGGGCTGAGCTGGGGAGACTTTGGAGACTGGAGTGACCATTGCCCCAAGGGCGCGTGCGGCCTGCAGACCAAGATCCAGGGACCTAGAGGCCTCGGCGATGACACTGCGCTGAACGACGCGCGCTTATTCTGCTGCCGCAGTTGA
Sequence Length
609
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
11,966 Da
NCBI Official Full Name
Homo sapiens vitelline membrane outer layer 1 homolog (chicken), mRNA
NCBI Official Synonym Full Names
vitelline membrane outer layer 1 homolog
NCBI Official Symbol
VMO1
NCBI Official Synonym Symbols
ERGA6350; PRO21055
NCBI Protein Information
vitelline membrane outer layer protein 1 homolog
UniProt Protein Name
Vitelline membrane outer layer protein 1 homolog
Protein Family
UniProt Gene Name
VMO1
UniProt Entry Name
VMO1_HUMAN
Uniprot Description
VMO1: Belongs to the VMO1 family.
Protein type: Secreted; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 17p13.2
Similar Products
Product Notes
The VMO1 vmo1 (Catalog #AAA1267423) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGAGCGGG GCGCAGGAGC CAAGCTGCTG CCGCTGCTGC TGCTTCTGCG GGCGACTGGT TTCACATGTG CACAGACAGA TGGCCGGAAC GGCTACACGG CGGTCATCGA AGTGACCAGC GGGGGTCCCT GGGGCGACTG GGCCTGGCCT GAGATGTGTC CCGATGGATT CTTCGCCAGC GGGTTCTCGC TCAAGGTGGA GCCTCCCCAA GGCATTCCTG GCGACGACAC TGCACTGAAT GGGATCAGGC TGCACTGCGC GCGCGGGAAC GTCCTAGGCA ATACGCACGT GGTAGAGTCC CAGTCTGGAA GCTGGGGCGA ATGGAGTGAG CCGCTGTGGT GTCGCGGCGG CGCCTACCTA GTGGCTTTCT CGCTTCGCGT GGAGGCACCC ACGACCCTCG GTGACAACAC AGCAGCGAAC AACGTGCGCT TCCGCTGTTC AGACGGCGAG GAACTGCAGG GGCCTGGGCT GAGCTGGGGA GACTTTGGAG ACTGGAGTGA CCATTGCCCC AAGGGCGCGT GCGGCCTGCA GACCAAGATC CAGGGACCTA GAGGCCTCGG CGATGACACT GCGCTGAACG ACGCGCGCTT ATTCTGCTGC CGCAGTTGA. It is sometimes possible for the material contained within the vial of "VMO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
