Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UXS1 cdna clone

UXS1 cDNA Clone

Gene Names
UXS1; UGD; SDR6E1
Synonyms
UXS1; UXS1 cDNA Clone; UXS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgagcaaggcgctgctgcgcctcgtgtctgccgtcaaccgcaggaggatgaagctgctgctgggcatcgccttgctggcctacgtcgcctctgtttggggcaacttcgttaatatgaggtctatccaggaaaatggtgaactaaaaattgaaagcaagattgaagagatggttgaaccactaagagagaaaatcagagatttagaaaaaagctttacccagaaatacccaccagtaaagtttttatcagaaaaggatcggaaaagaattttgataacaggaggcgcagggttcgtgggctcccatctaactgacaaactcatgatggacggccacgaggtgaccgtggtggacaatttcttcacgggcaggaagagaaacgtggagcactggatcggacatgagaacttcgagttgattaaccacgacgtggtggagcccctctacatcgaggttgaccagatataccatctggcatctccagcctcccctccaaactacatgtataatcctatcaagacattaaagaccaatacgattgggacattaaacatgttggggctggcaaaacgagtcggtgcccgtctgctcctggcctccacatcggaggtgtatggagatcctgaagtccaccctcaaagtgaggattactggggccacgtgaatccaataggacctcgggcctgctacgatgaaggcaaacgtgttgcagagaccatgtgctatgcctacatgaagcaggaaggcgtggaagtgcgagtggccagaatcttcaacacctttgggccacgcatgcacatgaacgatgggcgagtagtcagcaacttcatcctgcaggcgctccagggggagccactcacggtatacggatccgggtctcagacaagggcgttccagtacgtcagcgatctagtgaatggcctcgtggctctcatgaacagcaacgtcagcagcccggtcaacctggggaacccagaagaacacacaatcctagaatttgctcagttaattaaaaaccttgttggtagcggaagtgaaattcagtttctctccgaagcccaggatgacccacagaaaagaaaaccagacatcaaaaaagcaaagctgatgctggggtgggagcccgtggtcccgctggaggaaggtttaaacaaagcaattcactacttccgtaaagaactcgagtaccaggcaaataatcagtacatccccaaaccaaagcctgccagaataaagaaaggacggactcgccacagctga
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,275 Da
NCBI Official Full Name
Homo sapiens UDP-glucuronate decarboxylase 1, mRNA
NCBI Official Synonym Full Names
UDP-glucuronate decarboxylase 1
NCBI Official Symbol
UXS1
NCBI Official Synonym Symbols
UGD; SDR6E1
NCBI Protein Information
UDP-glucuronic acid decarboxylase 1
UniProt Protein Name
UDP-glucuronic acid decarboxylase 1
UniProt Gene Name
UXS1
UniProt Synonym Gene Names
UGD; UXS-1
UniProt Entry Name
UXS1_HUMAN

NCBI Description

This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]

Uniprot Description

UXS1: Catalyzes the NAD-dependent decarboxylation of UDP- glucuronic acid to UDP-xylose. Necessary for the biosynthesis of the core tetrasaccharide in glycosaminoglycan biosynthesis. Belongs to the sugar epimerase family. UDP-glucuronic acid decarboxylase subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - starch and sucrose; Lyase; Carbohydrate Metabolism - amino sugar and nucleotide sugar; EC 4.1.1.35; Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q12.2

Molecular Function: protein homodimerization activity; UDP-glucuronate decarboxylase activity

Biological Process: protein tetramerization

Research Articles on UXS1

Similar Products

Product Notes

The UXS1 uxs1 (Catalog #AAA1267608) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgagca aggcgctgct gcgcctcgtg tctgccgtca accgcaggag gatgaagctg ctgctgggca tcgccttgct ggcctacgtc gcctctgttt ggggcaactt cgttaatatg aggtctatcc aggaaaatgg tgaactaaaa attgaaagca agattgaaga gatggttgaa ccactaagag agaaaatcag agatttagaa aaaagcttta cccagaaata cccaccagta aagtttttat cagaaaagga tcggaaaaga attttgataa caggaggcgc agggttcgtg ggctcccatc taactgacaa actcatgatg gacggccacg aggtgaccgt ggtggacaat ttcttcacgg gcaggaagag aaacgtggag cactggatcg gacatgagaa cttcgagttg attaaccacg acgtggtgga gcccctctac atcgaggttg accagatata ccatctggca tctccagcct cccctccaaa ctacatgtat aatcctatca agacattaaa gaccaatacg attgggacat taaacatgtt ggggctggca aaacgagtcg gtgcccgtct gctcctggcc tccacatcgg aggtgtatgg agatcctgaa gtccaccctc aaagtgagga ttactggggc cacgtgaatc caataggacc tcgggcctgc tacgatgaag gcaaacgtgt tgcagagacc atgtgctatg cctacatgaa gcaggaaggc gtggaagtgc gagtggccag aatcttcaac acctttgggc cacgcatgca catgaacgat gggcgagtag tcagcaactt catcctgcag gcgctccagg gggagccact cacggtatac ggatccgggt ctcagacaag ggcgttccag tacgtcagcg atctagtgaa tggcctcgtg gctctcatga acagcaacgt cagcagcccg gtcaacctgg ggaacccaga agaacacaca atcctagaat ttgctcagtt aattaaaaac cttgttggta gcggaagtga aattcagttt ctctccgaag cccaggatga cccacagaaa agaaaaccag acatcaaaaa agcaaagctg atgctggggt gggagcccgt ggtcccgctg gaggaaggtt taaacaaagc aattcactac ttccgtaaag aactcgagta ccaggcaaat aatcagtaca tccccaaacc aaagcctgcc agaataaaga aaggacggac tcgccacagc tga. It is sometimes possible for the material contained within the vial of "UXS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.