USP45 cdna clone
USP45 cDNA Clone
Synonyms
USP45; USP45 cDNA Clone; USP45 cdna clone
Sequence
atgcgggtgaaagatccaactaaagctttacctgagaaagccaaaagaagtaaaaggcctactgtacctcatgatgaagactcttcagatgatattgctgtaggtttaacttgccaacatgtaagtcatgctatcagcgtgaatcatgtaaagagagcaatagctgagaatctgtggtcagtttgctcagaatgtttagaagaaagaagattctatgatgggcagctagtacttacttctgatatttggttgtgcctcaagtgtggcttccagggatgtggtaaaaactcagaaagccaacattcattgaagcactttaagagttccagaacagagccccattgtattataattaatctgagcacatggattatatggtgttatgaatgtgatgaaaaattatcaacgcattgtaataagaaggttttggctcagatagttgattttctccagaaacatgcttctaaaacacaaacaagtgcattttctagaatcatgaaactttgtgaagaaaaatgtgaaacagatgaaatacagaagggaggaaaatgcagaaatttatctgtaagaggaattacaaatttaggaaatacttgcttttttaatgcagtcatgcagaacttggcacagacttatactcttactgatctgatgaatgagatcaaagaaagtagtacaaaactcaagatttttccttcctcagactctcagctggacccattggtggtggaactttcaaggcctggaccactgacctcagccttgttcctgtttcttcacagcatgaaggagactgaaaaaggaccactttctcctaaagttctttttaatcagctttgtcagaagcgggtgcatctacatttaatataa
Sequence Length
870
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,812 Da
NCBI Official Full Name
Homo sapiens ubiquitin specific peptidase 45, mRNA
NCBI Official Synonym Full Names
ubiquitin specific peptidase 45
NCBI Official Symbol
USP45
NCBI Protein Information
ubiquitin carboxyl-terminal hydrolase 45
UniProt Protein Name
Ubiquitin carboxyl-terminal hydrolase 45
Protein Family
UniProt Gene Name
USP45
UniProt Entry Name
UBP45_HUMAN
Uniprot Description
USP45: Belongs to the peptidase C19 family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Protease; EC 3.4.19.12; Ubiquitin-specific protease; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 6q16.2
Cellular Component: cytoplasm; nucleoplasm; nucleus
Molecular Function: ubiquitin-specific protease activity
Biological Process: DNA repair; protein deubiquitination
Research Articles on USP45
Similar Products
Product Notes
The USP45 usp45 (Catalog #AAA1276325) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggtga aagatccaac taaagcttta cctgagaaag ccaaaagaag taaaaggcct actgtacctc atgatgaaga ctcttcagat gatattgctg taggtttaac ttgccaacat gtaagtcatg ctatcagcgt gaatcatgta aagagagcaa tagctgagaa tctgtggtca gtttgctcag aatgtttaga agaaagaaga ttctatgatg ggcagctagt acttacttct gatatttggt tgtgcctcaa gtgtggcttc cagggatgtg gtaaaaactc agaaagccaa cattcattga agcactttaa gagttccaga acagagcccc attgtattat aattaatctg agcacatgga ttatatggtg ttatgaatgt gatgaaaaat tatcaacgca ttgtaataag aaggttttgg ctcagatagt tgattttctc cagaaacatg cttctaaaac acaaacaagt gcattttcta gaatcatgaa actttgtgaa gaaaaatgtg aaacagatga aatacagaag ggaggaaaat gcagaaattt atctgtaaga ggaattacaa atttaggaaa tacttgcttt tttaatgcag tcatgcagaa cttggcacag acttatactc ttactgatct gatgaatgag atcaaagaaa gtagtacaaa actcaagatt tttccttcct cagactctca gctggaccca ttggtggtgg aactttcaag gcctggacca ctgacctcag ccttgttcct gtttcttcac agcatgaagg agactgaaaa aggaccactt tctcctaaag ttctttttaa tcagctttgt cagaagcggg tgcatctaca tttaatataa. It is sometimes possible for the material contained within the vial of "USP45, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
